|
|
||||||||
Department of Entomology, The Pennsylvania State University, 501 ASI Building, University Park, PA 16802, USA
Correspondence
Diana Cox-Foster
dxc12{at}psu.edu
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
We have focused upon two viruses, Kashmir bee virus (KBV) and sacbrood virus (SBV). The complete nucleotide sequences of KBV and SBV are available (de Miranda et al., 2004
; Ghosh et al., 1999
). KBV was first identified in adults of the eastern hive bee (Apis cerana) in the northern and western regions of India (Bailey & Woods, 1977
). Bees infected with KBV have no described symptoms, even though Bailey & Ball (1991)
and Allen & Ball (1995)
suggested that KBV is the most virulent of all known honeybee viruses. SBV was first described in 1913, but was not characterized until 1964 (Bailey et al., 1964
). SBV is possibly the most common viral disease of bees, being known on every continent (Dall, 1985
; Nixon, 1982
). SBV infects the brood of the honeybee, resulting in larval death. Larvae with sacbrood fail to pupate and ecdysial fluid, rich in SBV, accumulates beneath their unshed cuticle, forming the sac. SBV may also infect adult bees without any obvious signs of disease. Compared with KBV, SBV causes symptoms that can confidently be attributed to viral infection (Allen & Ball, 1996
).
Varroa was first described as a natural ectoparasitic mite of the eastern honeybee (A. cerana) and then switched host to the western honeybee (Apis mellifera) (Morse & Flottum, 1997
). Varroa has now become a serious pest of western honeybees worldwide and is associated with the collapse or death of honeybee colonies. Varroa females initiate reproduction by entering the brood cells of last-stage worker or drone larvae before the cell is sealed. The adult female mite and progeny feed on the haemolymph of pupae and emerge from the cell with the young bee. Varroa mites are also often found on the thorax and abdomen of adult bees and may hitch a ride on bees from a colony to infect other colonies. It is not clear how mites kill bee colonies, but the general assumption is that varroa mites may be vectors or activators of several bee viruses. Some researchers suggest that varroa-mite infestation may be correlated with viral infections (Ball & Allen, 1988
; Hung & Shimanuki, 1999
; Hung et al., 2000
). However, there is little direct evidence to link varroa mites with the occurrence of SBV in adult bees (Ball & Allen, 1988
). Multiple opportunities exist for transmission by mites, given the association of the mites with honeybees.
Several methods have been used to detect bee viruses, including immunodiffusion, ELISA, Western blot and RT-PCR (Anderson & Gibbs, 1988
; Grabensteiner et al., 2001
; Hung & Shimanuki, 1999
; Stoltz et al., 1995
; Turcu et al., 1994
). Diagnosis of bee viruses based on observed symptoms is not always dependable, as bees infected with many viruses may have no symptoms and the viruses are capable of remaining dormant for extended periods of time without any apparent harm to the host. Dall (1985)
reported that both KBV and SBV persisted as inapparent infections in seemingly healthy worker-bee pupae and the viruses replicated to detectable concentrations when the pupae were injected with rabbit sera or insect Ringer's solution. The persistence of inapparent viral infections in honeybees has some similarities to infections by picornaviruses and other viruses within the picornavirus superfamily. For example, Foot-and-mouth disease virus is a member of the family Picornaviridae and may cause a prolonged, asymptomatic and persistent infection in ruminants (Alexandersen et al., 2002
). Girard et al. (2002)
reported that Poliovirus persisted in the central nervous system of infected paralysed mice for over a year after the acute phase of paralytic poliomyelitis.
Viral transmission between bees is poorly understood. KBV is detected in the faeces of worker and queen honeybees (A. mellifera) (Hung, 2000
). The study by Hung (2000)
indicated that the queen can be infected, but did not demonstrate direct evidence for transmission via faeces. The queen, under normal conditions, is responsible for laying all of the eggs in the colony (several hundred to thousands per day). It is possible that the queen could transmit viruses to eggs by transovarial transmission. Previously, there have been no reports of viruses in honeybee eggs. Another route of transmission may be through the food consumed by the larvae and adult bees. The vast majority of individuals in a bee colony are worker bees, which are responsible for feeding the colony. For the first 2 or 3 weeks of adult life, workers stay inside the hive and feed the brood and queen. After this period, the workers forage and bring back nectar, pollen and water. All of these food products are stored and used to feed the larvae, queen and other adults. All of the food, including honey, pollen and royal jelly, is in part composed of secretions from the hypopharyngeal and mandibular glands of the young adult workers. The queen larvae are always mass-fed a diet of royal jelly. Worker larvae are also mass-fed royal jelly for the first 3 days. After the fourth day, the worker larvae are fed, progressively or as needed, with a diet called worker jelly or brood food. This diet consists of royal jelly, honey and probably some pollen. Bailey (1969)
showed that more SBV accumulated in the heads and especially in the hypopharyngeal glands of infected worker bees. Therefore, SBV may potentially be transmitted via glandular secretions of the worker bees in the form of food products, but this has not been demonstrated previously.
In this paper, we have developed specific and sensitive methods for diagnosis of KBV infection and studied the presence of KBV in single bees comparatively by ELISA and RT-PCR. To better define the potential transmission routes for bee viruses, we have compared the presence of KBV and SBV in different developmental stages and castes of bees. We have determined whether KBV and SBV could be transmitted from queen bees to eggs via transovarial transmission by testing for viral RNA and capsid proteins in queen bees and viral RNA in egg samples. We were also interested in determining whether food sources (brood food, honey, pollen and royal jelly) were contaminated by these viruses and could be potential sources for horizontal transmission of viruses. In addition, this research provides direct evidence for the potential role of varroa mites in vectoring bee viruses (KBV and SBV). Overall, this research increases our understanding of the complex relationships among honey bees, varroa mites and viral infections.
| METHODS |
|---|
|
|
|---|
To develop and validate the methods for KBV detection, 16 5-day-old pupae collected from colony 15 in the Penn State apiary were injected with 4 µl ELISA KBV-positive samples. Fifteen uninjected pupae from the same colony served as controls. Both the injected and uninjected pupae were incubated on dry filter paper in small Petri dishes placed in a larger Petri dish lined with filter paper wetted with 12 % glycerol to humidify the air, and were kept in an incubator (35 °C, relative humidity 50 %) for 4 days.
Egg samples were collected carefully from individual cells and washed well with distilled water. For each sample, 20 eggs were pooled and tested. The larval, pupal and adult bees were frozen at 80 °C. To test the presence of viruses in food resources, larval food and royal jelly were collected carefully from cells by removing the worker or queen larvae. Pollen and honey were collected from comb cells.
Sample preparations.
The larval, pupal and adult bees frozen at 80 °C were cut into half laterally, with one half used for ELISA and the other half for RT-PCR. For ELISA, the half-single-bee samples were homogenized in 400 µl extraction buffer (PBS with 0·2 % diethyldithiocarbamate) and clarified with chloroform. Mites, tested for ELISA, were divided randomly into nine groups of 12 mites each. Extracts from each group of mites in 60 µl extraction buffer were prepared in a similar manner as for the bee samples. Supernatants of the sample extracts were kept on ice and used directly for ELISA or saved at 20 °C for future use. To test whether mite saliva contains KBV, mites were allowed to feed on sterile tissue-culture medium through an artificial membrane (2025 mites per membrane). After 24 h, the culture medium was collected and assayed for KBV by ELISA.
For RT-PCR, total RNA from the bee samples (pooled eggs, larvae, pupae and adults), mites and food sources (larval food, royal jelly, pollen and honey) was extracted by using TRIzol reagent (Invitrogen). RNA from the egg and mite samples was resuspended in 10 µl DEPC-treated water.
Expression of KBV proteins in bacteria, and polyclonal antibodies.
Two fragments of KBV, AD and Odt (Fig. 1a
), were cloned directionally into pQE-30 (Qiagen). Expression and purification of the recombinant proteins were performed by using Ni-NTA columns under denaturing conditions according to the manufacturer's instructions (Qiagen). The recombinant proteins were further purified by preparative SDS-PAGE (12 % gel) (Sambrook et al., 1989
). The protein bands of interest were excised and electro-eluted. The purified proteins were dialysed in PBS and used to raise polyclonal antisera (Pocono Rabbit Farm and Laboratory Inc., Canadensis, PA, USA). The antiserum against another structural protein, VP4, was produced against KBV VP4 (Stoltz et al., 1995
) and received as a gift from Dr Don Stoltz, Dalhousie University, Canada.
|
RT-PCR.
The genomic sequences of SBV (GenBank accession no. AF092924) and KBV (GenBank accession no. AY275710) were aligned by using the Genetics Computer Group (GCG) program, version 10.1. Primers were designed for their specificity to KBV (KBV-F, ATGACGATGATGAGTTCAAG; KBV-R, AATTGCAAGACCTGCATC) or SBV (SBV-F, CACTCAACTTACACAAAAAC; SBV-R, CATTAACTACTCTCACTTTC). Primers (actin-F, ATGAAGATCCTTACAGAAAG; actin-R, TCTTGTTTAGAGATCCACAT) were used to amplify 514 bp of the honeybee actin gene (GenBank accession no. BI504901) as an internal control. cDNA synthesis was performed by using moloney murine leukemia virus reverse transcriptase (Promega) and random primers in a volume of 20 µl. RNA from bee samples (2 µg) and 0·5 vol. RNA from beehive products (honey, pollen, royal jelly and brood food) and mite samples was used for cDNA synthesis. PCR was carried out by using a program of initial denaturing for 5 min at 94 °C and 35 cycles of 94 °C for 20 s, 50 °C for 20 s and 72 °C for 1 min. A 5 µl aliquot of the RT-PCR product was electrophoresed in a 1·5 % agarose gel, stained with ethidium bromide and imaged by using a Kodak digital-image system. Fragment sizes were determined relative to a 100 bp DNA ladder (Promega). A negative control lacking template DNA and a positive cDNA control were performed for each PCR.
Data analysis.
Student's t-test (STATVIEW statistical package, version 5.0.1; SAS Institute Inc.) was used to analyse the data.
| RESULTS |
|---|
|
|
|---|
To test the specificity of the antibodies, we selected nine samples for the detection of KBV by ELISA and Western blot (Fig. 2
). Four of the nine samples were positive for capsid proteins by ELISA using anti-VP4. Similar results were obtained by Western blot using the three KBV antibodies. As the recombinant proteins Odt and AD corresponded to more than one putative KBV capsid protein, multiple bands were detected. All of the protein bands detected by anti-AD and anti-Odt antibodies were within the 2035 kDa size range, which is in agreement with the predicted sizes of the major coat proteins (Liljas et al., 2002
) and is also consistent with the sizes of the coat proteins detected in purified KBV separated by SDS-PAGE (Stoltz et al., 1995
). However, anti-AD reacted with VP2 and VP3 but, surprisingly, did not react with VP4. Anti-Odt reacted with VP3 and VP1. Anti-VP4 reacted with only VP4. The results demonstrated that the three KBV antibodies were specific for KBV capsid proteins, did not react with bee proteins and did not cross-react with SBV. The low level (<25 %) of amino acid identity between the structural proteins of KBV and SBV, as determined by BLAST analysis, may have precluded the cross-reactivity of the antisera.
|
|
50 % of the bees had SBV infections and most, if not all, occurred as KBV/SBV co-infections.
|
Transmission routes of honeybee viruses
To test whether bee viruses (KBV and SBV) could be transmitted vertically from the queen to the eggs, we collected 21 queens from the 20 colonies and three egg samples from two of these 20 colonies (colonies 216 and 14). Both KBV and SBV RNA fragments were amplified from queen and egg samples (Table 2
), indicating that these viruses may be transmitted from the queen to the eggs via transovarial transmission. KBV RNA was amplified in 71·4 % (15/21) of the queens and SBV RNA was amplified in 61·9 % (13/21) of the queens, indicating that the majority of queens had KBV and SBV co-infections. As several of the queens were known to be 2 years old, viral infections might not have affected their longevity.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
We hypothesized that bee viruses (KBV and SBV) can be vectored by varroa mites and transmitted by both vertical- and/or horizontal-transmission routes among honeybees (Fig. 5
). Anderson (1985)
suggested that KBV could be transmitted by other means, as KBV was reported in Canada before the introduction of varroa mites to that country. Our results demonstrated that bee viruses (KBV and SBV) could potentially be transmitted either vertically from the queen to the eggs via transovarial transmission, or horizontally from workers to larvae or other bees via food sources containing glandular secretions. KBV and SBV were detected in both queens and eggs by RT-PCR, which indicates a route of transovarial transmission. Previously, Hung (2000)
detected KBV in the faecal materials of worker and queen bees. In his experiment, queens were confined individually in separate Petri dishes. The faecal material was collected from each queen with a micropipette as soon as they defecated. In this experiment, one out of three queen excreta was positive by RT-PCR, suggesting that KBV was present in queens and that other bees could become infected when cleaning the hive.
|
KBV and SBV can be detected simultaneously in an individual honeybee. Both viral RNAs could be amplified in the different developmental stages of bees, such as eggs, larvae, pupae and adults of queens, workers and drones. About half of the bee samples (69/139) had both KBV and SBV in the same bee, suggesting that these viruses could infect the same honeybee simultaneously, with both viruses being detected at high levels. Based upon serological tests, Anderson & Gibbs (1988)
reported simultaneous, unapparent infections of KBV, SBV and Black queen cell virus (BQCV). When activated, KBV was thought to suppress the replication of SBV and BQCV. However, we did not observe this. In addition, Dall (1985)
reported that there was no instance of mixed infection of KBV and SBV in bees in Australia. The reason for this discrepancy may lie in the difference of sensitivity of the virus-detection methods.
Varroa mites can be vectors for KBV and SBV. The worldwide spread of varroa mites in honeybee colonies has had a significant influence on viral infections in bees (Bakonyi et al., 2002
). In Britain, before the invasion of the varroa mite, Acute bee paralysis virus (ABPV) never caused bee mortality whereas, after the invasion, bee mortality increased due to ABPV (Allen et al., 1986
; Batuev, 1979
). Allen et al. (1986)
and Batuev (1979)
suggested that varroa was associated with ABPV. By using immunodiffusion tests, Ball & Allen (1988)
compared the prevalence of bee viruses in dead-bee samples from colonies infested with varroa mites with bees in uninfested colonies. The results demonstrated that ABPV titres were significantly higher in bee samples with varroa mites. They suggested that ABPV was the primary cause of adult bee mortality in honeybee colonies infested severely with Varroa jacobsoni. The authors suggested that the varroa mite potentially activated ABPV replication in adult bees by its feeding behaviour and potentially transmitted the virus from adult bees to pupae (Ball, 1983
; Ball & Allen, 1988
). In a review, Bailey & Ball (1991)
suggested the possibility that varroa mites may transmit KBV in the same manner as they do ABPV. Hung & Shimanuki (1999)
and Hung et al. (2000)
detected KBV in varroa mites by using RT-PCR. In our study, we have demonstrated that KBV and SBV can be detected simultaneously in varroa mites. Moreover, our detection of KBV capsid proteins in varroa-mite saliva suggests that varroa mites may potentially vector KBV via their saliva. Therefore, varroa mites may transmit viruses to bees during feeding. Also, RNAs of KBV and SBV can be detected in mites, even in single mites, indicating that the mites may also be infected with the virus. The intensity of this reaction suggested that the virus was present at high levels and was not just found in mouthparts or the digestive tract.
More recently, increasing knowledge of the interactions between honeybee viruses and parasitic mites (varroa mites and tracheal mites) has led to the suggestion that interactions may underlie honeybee mortality and colony collapse (Allen et al., 1986
; Batuev, 1979
; Brødsgaard et al., 2000
; Korpela et al., 1992
). To date, this relationship between the mite infestation and viral infection is not clearly understood. Also, there is little support for an increased SBV infection with varroa-mite infestation in adult bees. Our research has provided direct evidence for the role of varroa in vectoring bee viruses (KBV and SBV). In addition, we are testing the role of varroa mites in inducing viral infections in bees, and examining the interaction of these viruses and mite tissues.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Allen, M. F. & Ball, B. V. (1995). Characterization and serological relationships of strains of Kashmir bee virus. Ann Appl Biol 126, 471484.
Allen, M. & Ball, B. (1996). The incidence and world distribution of the honey bee viruses. Bee World 77, 141162.
Allen, M. F., Ball, B. V., White, R. F. & Antoniw, J. F. (1986). The detection of acute paralysis virus in Varroa jacobsoni by the use of a simple indirect ELISA. J Apic Res 25, 100105.
Anderson, D. L. (1985). Inapparent virus infections in honey bee (Apis mellifera Linnaeus) pupae. In Proceedings of the Fourth Australasian Conference on Grassland Invertebrate Ecology, New Zealand 1985, pp. 244254. Edited by R. B. Chapman. Christchurch, New Zealand: Caxton Press.
Anderson, D. L. & Gibbs, A. J. (1988). Kashmir bee virus (KBV) occurs in Australia and the United States, but is not reported in Hawaii. Am Bee J 137, 767768.
Bailey, L. (1969). The multiplication and spread of sacbrood virus of bees. Ann Appl Biol 63, 483491.[Medline]
Bailey, L. & Woods, R. D. (1977). Two more small RNA viruses from honey bees and further observations on sacbrood and acute bee-paralysis viruses. J Gen Virol 37, 175182.
Bailey, L. & Ball, B. V. (1991). Honey Bee Pathology, 2nd edn. London: Academic Press.
Bailey, L., Gibbs, A. J. & Woods, R. D. (1964). Sacbrood virus of the larval honey bee (Apis mellifera Linnaeus). Virology 23, 425429.[Medline]
Bakonyi, T., Grabensteiner, E., Kolodziejek, J., Rusvai, M., Topolska, G., Ritter, W. & Nowotny, N. (2002). Phylogenetic analysis of acute bee paralysis virus strains. Appl Environ Microbiol 68, 64466450.
Ball, B. V. (1983). The association of Varroa jacobsoni with virus diseases of honey bees. In Proceedings of a Meeting of the EC Experts' Group, Wageningen, 79 February 1983. Rotterdam: A. A. Balkema.
Ball, B. V. & Allen, M. F. (1988). The prevalence of pathogens in honey bee (Apis mellifera) colonies infested with the parasitic mite Varroa jacobsoni. Ann Appl Biol 113, 237244.
Batuev, Y. M. (1979). New information about virus paralysis. Pchelovodstvo 7, 1011 (in Russian).
Brødsgaard, C. J., Ritter, W., Hansen, H. & Brødsgaard, H. F. (2000). Interactions among Varroa jacobsoni mites, acute paralysis virus, and Paenibacillus larvae larvae and their influence on mortality of larval honeybees in vitro. Apidologie 31, 543554.[CrossRef]
Dall, D. J. (1985). Inapparent infection of honey bee pupae by Kashmir and sacbrood bee viruses in Australia. Ann Appl Biol 106, 461468.
de Miranda, J. R., Drebot, M., Tyler, S., Shen, M., Cameron, C. E., Stoltz, D. B. & Camazine, S. M. (2004). Complete nucleotide sequence of Kashmir bee virus and comparison with acute bee paralysis virus. J Gen Virol 85, 22632270.
Ghosh, R. C., Ball, B. V., Willcocks, M. M. & Carter, M. J. (1999). The nucleotide sequence of sacbrood virus of the honey bee: an insect picorna-like virus. J Gen Virol 80, 15411549.[Abstract]
Girard, S., Gosselin, A.-S., Pelletier, I., Colbère-Garapin, F., Couderc, T. & Blondel, B. (2002). Restriction of poliovirus RNA replication in persistently infected nerve cells. J Gen Virol 83, 10871093.
Grabensteiner, E., Ritter, W., Carter, M. J. & 8 other authors (2001). Sacbrood virus of the honeybee (Apis mellifera): rapid identification and phylogenetic analysis using reverse transcription-PCR. Clin Diagn Lab Immunol 8, 93104.
Harlow, E. & Lane, D. (1999). Using Antibodies: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Hung, A. C. F. (2000). PCR detection of Kashmir bee virus in honey bee excreta. J Apic Res 39, 103106.
Hung, A. C. F. & Shimanuki, H. (1999). A scientific note on the detection of Kashmir bee virus in individual honeybees and Varroa jacobsoni mites. Apidologie 30, 353354.
Hung, A. C. F., Peng, Y. S. C. & Shimanuki, H. (2000). Nucleotide sequence variations in Kashmir bee virus isolated from Apis mellifera L. and Varroa jacobsoni Oud. Apidologie 31, 1723.
Jan, E., Kinzy, T. G. & Sarnow, P. (2003). Divergent tRNA-like element supports initiation, elongation, and termination of protein biosynthesis. Proc Natl Acad Sci U S A 100, 1541015415.
Korpela, S., Aarhus, A., Fries, I. & Hansen, H. (1992). Varroa jacobsoni Oud. in cold climates: population growth, winter mortality and influence on the survival of honey bee colonies. J Apic Res 31, 157164.
Liljas, L., Tate, J., Lin, T., Christian, P. & Johnson, J. E. (2002). Evolutionary and taxonomic implications of conserved structural motifs between picornaviruses and insect picorna-like viruses. Arch Virol 147, 5984.[CrossRef][Medline]
Morse, R. A. & Hooper, T. (1985). The Illustrated Encyclopedia of Beekeeping. New York: E. P. Dutton.
Morse, R. A. & Flottum, K. (1997). In Honey Bee Pests, Predators, and Diseases, pp. 2122, 3rd edn. Medina, OH: A. I. Root Company.
Nakashima, N., Sasaki, J. & Toriyama, S. (1999). Determining the nucleotide sequence and capsid-coding region of Himetobi P virus: a member of a novel group of RNA viruses that infect insects. Arch Virol 144, 20512058.[CrossRef][Medline]
Nixon, M. (1982). Preliminary world maps of honey bee diseases and parasites. Bee World 63, 2342.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sasaki, J. & Nakashima, N. (1999). Translation initiation at the CUU codon is mediated by the internal ribosome entry site of an insect picorna-like virus in vitro. J Virol 73, 12191226.
Sasaki, J. & Nakashima, N. (2000). Methionine-independent initiation of translation in the capsid protein of an insect RNA virus. Proc Natl Acad Sci U S A 97, 15121515.
Stoltz, D., Shen, X.-R., Boggis, C. & Sisson, G. (1995). Molecular diagnosis of Kashmir bee virus infection. J Apic Res 34, 153160.
Turcu, D., Gradinaru, D. A., Mardare, A. & Gradinaru, D. A. (1994). Electron microscopy and double agar gel immunodiffusion demonstration of bee viruses. Stud Res Vet Med 2, 7376.
Received 31 January 2005;
accepted 11 March 2005.
This article has been cited by other articles:
![]() |
S. Gisder, P. Aumeier, and E. Genersch Deformed wing virus: replication and viral load in mites (Varroa destructor) J. Gen. Virol., February 1, 2009; 90(2): 463 - 467. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fujiyuki, S. Ohka, H. Takeuchi, M. Ono, A. Nomoto, and T. Kubo Prevalence and Phylogeny of Kakugo Virus, a Novel Insect Picorna-Like Virus That Infects the Honeybee (Apis mellifera L.), under Various Colony Conditions J. Virol., December 1, 2006; 80(23): 11528 - 11538. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |