J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ng, A.
Right arrow Articles by Smith, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ng, A.
Right arrow Articles by Smith, G. L.
Agricola
Right arrow Articles by Ng, A.
Right arrow Articles by Smith, G. L.
Journal of General Virology (2001), 82, 2095-2105.
© 2001 Society for General Microbiology


Animal: DNA Viruses

The vaccinia virus A41L protein is a soluble 30 kDa glycoprotein that affects virus virulence

Aylwin Ngb,1, David C. Tscharkec,1, Patrick C. Readingd,1 and Geoffrey L. Smith1

Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, UK1

Author for correspondence: Geoffrey Smith. Present address: The Wright–Fleming Institute, Imperial College, School of Medicine, St Mary’s Campus, Norfolk Place, London W2 1PG, UK. Fax +44 207 594 3973. e-mail glsmith{at}ic.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Vaccinia virus (VV) gene A41L encodes an acidic protein with amino acid similarity to the 35 kDa protein of VV strain Lister, a soluble protein called vCKBP that binds CC chemokines, and to a protein from orf virus, called GIF, that binds GM-CSF and IL-2. However, despite the similarity, recombinant A41L protein was found not to bind these ligands or a variety of other chemoattractant molecules when tested using surface plasmon resonance. The A41L gene is expressed early and late during infection and encodes a 30 kDa protein that contains both N- and O-linked carbohydrate and is secreted from the infected cell. All 16 strains of VV and 2 strains of cowpox virus that were tested express the A41L protein, implying it has an important function for orthopoxviruses. Nonetheless, a VV strain Western Reserve deletion mutant lacking the A41L gene (v{Delta}A41L) formed normal sized plaques and replicated to the same titre as wild-type and revertant viruses. The importance of the A41L protein in vivo was demonstrated in a mouse intradermal model in which infection with v{Delta}A41L caused more severe lesions compared to wild-type and revertant viruses. Further examination in this model revealed that deletion of A41L enhanced clearance of infectious virus, suggesting that A41L expression reduces immunopathology. Consistent with this, histological examination of infected rabbit skin showed that the A41L protein could reduce the infiltration of inflammatory cells into the infected area. Together, these data suggest that the A41L protein constitutes a novel immunomodulatory protein.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Poxviruses are a group of large DNA viruses that replicate in the cytoplasm of the cell and encode many virulence factors (Moss, 1996Down ). Vaccinia virus (VV) is the most intensively studied poxvirus and is the live vaccine that was used to eradicate smallpox (Fenner et al., 1988Down ). The genomes of VV strains Copenhagen (Goebel et al., 1990Down ), MVA (Antoine et al., 1998Down ) and Tian Tan (accession no. AF095689) have been sequenced and each contains approximately 200 genes. Genes located towards either end of the genome are variable between different orthopoxviruses and many are non-essential for virus replication (Johnson et al., 1993Down ). A subset of these non-essential genes is important for blocking components of the host immune system and affects virus virulence. For instance, VV and other poxviruses express proteins that are secreted from the infected cell and block the action of interferons, complement, cytokines, chemokines, inflammation and fever (Spriggs, 1996Down ; G. L. Smith et al., 1997Down ; Alcamí & Kosinowski, 2000Down ).

Previously, it was demonstrated that VV strain Lister expresses a 35 kDa protein that is secreted from infected cells (Patel et al., 1990Down ) and binds many CC chemokines (Graham et al., 1997Down ; C. A. Smith et al., 1997Down ; Alcamí et al., 1998Down ). This protein was called virus chemokine binding protein (vCKBP) (Alcamí et al., 1998Down ). Closely related proteins are made by some other (but not all) VV strains, cowpox virus and variola virus, and the crystal structure of the cowpox virus protein has been determined (Carfí et al., 1999Down ). A more distantly related protein, called T1, is encoded by Shope fibroma virus (SFV) (Upton et al., 1987Down ) and this also binds CC chemokines (Graham et al., 1997Down ). More recently, another member of this family of secreted proteins was found to be expressed by orf virus and called GIF. However, unlike the other family members which all bind chemokines, GIF binds interleukin (IL)-2 and granulocyte macrophage colony stimulating factor (GM-CSF) (Deane et al., 2000Down ).

Previous bioinformatic studies showed that VV encodes another protein related to SFV T1 and other members of this family (Howard et al., 1991Down ). This gene was called SalF4L in VV strain WR (Howard et al., 1991Down ) but is called A41L using VV strain Copenhagen nomenclature (Goebel et al., 1990Down ). It was noted that the A41L protein had a putative signal peptide, a potential site for attachment of N-linked carbohydrate and, when aligned with the SFV T1 protein, all eight cysteine residues were conserved (Howard et al., 1991Down ). The gene is conserved in variola major virus strains Harvey (Aguado et al., 1992Down ), Bangladesh-1975 (Massung et al., 1994Down ) and India-1970 (Shchelkunov et al., 1994Down ) and the predicted protein has more than 95% amino acid identity to the VV WR A41L protein. The protein is also conserved in camelpox virus (C. Gubser & G. L. Smith, unpublished data).

The similarity of the A41L protein to vCKBP and SFV T1 suggested that it too might bind chemokines. On the basis of previous work with VV WR (which encodes A41L but not vCKBP), macrophage inflammatory protein (MIP)-1{alpha}, RANTES, IL-8 and growth related oncogene (GRO)-{alpha} can be ruled out as ligands for the A41L protein (Alcamí et al., 1998Down ), but many more chemokines remained untested.

Here we demonstrate that gene A41L encodes a 30 kDa glycoprotein that is secreted from cells infected by all strains of orthopoxvirus examined. A VV WR mutant lacking the A41L gene replicated normally in cell culture, but was distinguishable from wild-type and revertants in vivo in two models of dermal infection. In both models, A41L expression was associated with an altered inflammatory response to VV infection. Recombinant A41L protein made by either baculovirus, yeast (Pichia pastoris) or as an Fc-fusion in mammalian cells (CHO and COS-7) was used to examine the binding of a range of chemoattractant molecules using surface plasmon resonance (BIAcore); however, to date we have been unable to identify the ligand/s for A41L.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and viruses.
The origins of the orthopoxviruses used in this study were described previously (Alcamí et al., 1998Down ). VV strain WR was grown in BS-C-1 cells in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated foetal bovine serum (FBS) and was titrated on these cells as described previously (Mackett et al., 1985Down ). D980R and CV-1 cells were grown in DMEM containing 10% FBS.

{blacksquare} Chemokines and cytokines.
Recombinant human chemokines IL-8, neutrophil activating protein (NAP)-2, GRO-{alpha}, stromal-derived factor (SDF)-1{alpha}, monokine-induced by interferon-{gamma} (MIG), interferon-{gamma}-induced protein (IP)-10, interferon-inducible T cell {alpha} chemoattractant (ITAC), RANTES, MIP-1{alpha}, macrophage/monocyte chemotactic protein (MCP)-2, eotaxin, thymus and activation regulated chemokine (TARC), liver expressed chemokine (LEC), MIP-1{beta}, MCP-3 and recombinant murine MIP-1 {gamma}, IL-2, IL-3, IL-4, GM-CSF and stem cell factor (SCF) were purchased from PeproTech. GRO-{gamma} and I-309 were purchased from R&D Systems, and the anaphylatoxin C5a was purchased from Sigma. Human pulmonary and activation regulated chemokine (PARC) and murine MIP-1{alpha}, eotaxin, MCP-1 and MIP-2 were kindly provided by Amanda Proudfoot and Tim Wells (Serono Pharmaceutical Research Institute, Geneva, Switzerland).

{blacksquare} Construction of VV A41L deletion and revertant viruses.
A plasmid suitable for the construction of a VV strain WR mutant lacking the A41L gene by transient dominant selection (Falkner & Moss, 1990Down ) was assembled by PCR and DNA cloning. Oligonucleotides 5' CCCAAGCTTGGAGGAAGGACGTAATGC and 5' CGCGGATCCAAGAATGGTCAACCACG (left flank), and 5' CGCGGATCCTCTGCAATATTGTTATCG and 5' CCCGAATTCTCATCCATTAGAGAG (right flank), from the left or right side of the A41L gene, were used together with plasmid pSalIF (Smith et al., 1991Down ) to generate PCR products that contained terminal HindIII and BamHI (left flank) or BamHI and EcoRI (right flank) restriction enzyme sites. These PCR fragments were digested with the appropriate restriction enzymes and cloned sequentially into plasmid pSJH7 cut with the same enzymes (Hughes et al., 1991Down ) to form plasmid p{Delta}A41L. This plasmid lacked 90% of the A41L ORF (codons 1–201) and contained the E. coli guanylphosphoribosyltransferase gene (Ecogpt) (Boyle & Coupar, 1988Down ) under the control of the VV p7.5K promoter (Mackett & Smith, 1982Down ). The sequence of the PCR-derived regions of the plasmid was confirmed by DNA sequencing. Plasmid p{Delta}A41L was transfected into CV-1 cells infected with VV strain WR at 0·05 p.f.u. per cell and mycophenolic acid (MPA)-resistant virus was isolated by plaque assay (Falkner & Moss, 1988Down ). MPA-resistant virus was resolved into wild-type (vA41L) and deletion mutant viruses (v{Delta}A41L) on D980R cells in the presence of 6-thioguanine (6-TG) as described (Kerr & Smith, 1991Down ). These viruses were distinguished by PCR using oligonucleotides flanking the A41L gene.

A revertant virus (vA41L-rev) in which the A41L gene was re-inserted into its natural locus of v{Delta}A41L was constructed by transient dominant selection using plasmid pA41L, which contained the complete A41L gene and flanking sequences cloned between the SalI and EcoRI sites of plasmid pSJH7. pA41L was transfected into v{Delta}A41L-infected CV-1 cells and MPA-resistant virus was isolated as described above. This virus was then plated onto D980R cells in the presence of 6-TG and 6-TG-resistant viruses were screened for a wild-type A41L genotype by PCR (as above).

{blacksquare} Expression and purification of A41L protein from recombinant baculovirus.
The A41L ORF was amplified by PCR using pSalIF as template (Smith et al., 1991Down ) and oligonucleotides (5' CCCAAGCTTGCAGAATGTACTCG and 5' CCGCTCGAGACAATTATCAAATTTTTTCTT) that introduced 5' and 3' HindIII and XhoI sites (underlined), respectively. The DNA fragment was digested with these enzymes and cloned into HindIII- and XhoI-cut pBAC-1 (R&D Systems) generating plasmid pAcA41Lhis so that the A41L ORF was downstream of the Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedron gene promoter and linked to six histidine residues at the C terminus. Plasmid pAcA41Lhis and linear AcNPV DNA (BacPAK6, Clontech) were used to construct recombinant baculoviruses pAcA41Lhis by transfection into Spodoptera frugiperda (Sf)21 cells (Alcamí et al., 1998Down ). To produce A41Lhis protein, Sf21 cells were infected at 10 p.f.u. per cell and at 60 h post-infection (p.i.) the supernatant was clarified by centrifugation to remove cellular debris, filtered through a 0·2 µm filter (Nalgene) and then centrifuged at 20000 r.p.m. (SW28 rotor in a Beckman L8-M ultracentrifuge) for 30 min at 4 °C to pellet virus particles. The supernatant was dialysed against 20 mM Tris–HCl (pH 7·9) in 500 mM NaCl, and the A41Lhis protein was purified by Ni2+ chelate affinity chromatography followed by fast protein liquid chromatography (FPLC) using a MonoQ anion exchanger (Pharmacia). A41Lhis bound to mono-Q at pH 7·0 and was eluted in a salt gradient at 300 mM NaCl. The protein concentration was determined by the Bradford assay and by comparisons with known concentrations of BSA standards on SDS–PAGE.

{blacksquare} Immunization of rabbit to produce anti-A41L rabbit serum.
New Zealand White rabbits were injected intramuscularly with 80 µg of purified A41Lhis protein emulsified with an equal volume of Freund’s complete adjuvant and boosted three times at 3 week intervals with 200 µg of the same antigen emulsified in Freund’s incomplete adjuvant. Pre-immune and immune serum samples were taken prior to immunization and 2 weeks after the final immunization, respectively.

{blacksquare} Immunoblotting.
BS-C-1 cells were infected with the indicated orthopoxviruses at 10 p.f.u. per cell for 16 h and supernatants were prepared as described (Alcamí & Smith, 1995Down ). Sf21 cells were infected with AcNPV or AcA41Lhis at 10 p.f.u. per cell and 3 days later the supernatants were harvested and clarified by centrifugation (2000 g, 10 min at 4 °C). All samples were resolved by SDS–PAGE on 10% gels. After electrophoretic transfer of proteins to nitrocellulose membranes (Towbin et al., 1979Down ), the blots were incubated sequentially with rabbit anti-A41L serum (diluted 1:2000), a goat anti-rabbit peroxidase-conjugate, and ECL reagents (Amersham) as described (Parkinson & Smith, 1994Down ).

{blacksquare} Surface plasmon resonance (BIAcore) analysis.
Purified recombinant A41L or vCKBP (350 ng) was coupled to the surface of a CM5 BIAcore sensor chip. Recombinant chemoattractant molecules (e.g. cytokines, anaphylatoxin C5a, and chemokines from the CXC and CC families) were passed across the sensor chip and a positive interaction of the chemoattractant molecule (analyte) with the surface-coupled proteins (ligand) was indicated by an increase in the final base line (in response units) after the injected analyte had been eluted from the flow cells. After each injection of analyte, the sensor chip surface was regenerated with a 5 µl pulse of 0·1 M HCl, to strip the bound analyte off the ligand, and to prepare the chip surface for the next chemoattractant molecule to be injected.

{blacksquare} Mouse intradermal model.
Groups of female BALB/c mice, between 8 and 12 weeks of age, were infected by intradermal injection into ear pinnae of 104 or 106 p.f.u. of vA41L, v{Delta}A41L and vA41L-rev in 10  µl of PBS, and the diameter of lesions appearing on infected ears was estimated daily as described (Tscharke & Smith, 1999Down ). To measure the amount of infectious virus at the infection site, mice were sacrificed and infected ear lobes removed and frozen in 1 ml of culture medium. The whole sample was then thawed, ground with a small tapered tissue grinder (Wheaton) and subjected to two rounds of freezing and thawing followed by sonication before the titre of infectious virus was determined by plaque assay. The limit of sensitivity was 5 p.f.u. per ear lobe.

{blacksquare} Histological examination of VV-induced lesions in a rabbit skin model.
VVs vA41L, v{Delta}A41L and vA41L-rev were diluted in PBS and 104, 105 or 106 p.f.u. per site were injected subcutaneously along the flanks of a female New Zealand White rabbit, which was sacrificed 3 days p.i. Biopsy tissue samples were frozen using O.C.T. Tissue-Tek (Bayer Diagnostics) in an isopentane bath over dry ice for cryosectioning. The cryosections (10 µm thick) were placed on glass slides (Horwell Superfrost), fixed in 2% (w/v) paraformaldehyde on ice and subjected to membrane permeabilization with 0·1% Triton-X 100 in PBS. Samples were quenched at 37 °C for 5 min to remove endogenous peroxidase using glucose oxidase (0·5 units/ml) in 0·1 M phosphate buffer (pH 7·4) containing 0·2% (w/v) glucose and 1 mM sodium azide, followed by three washes with PBS (containing 0·1% Triton), and blocking for 30 min with 5% normal horse serum (Sigma). The sections were then either immunostained with mouse anti-rabbit CD43 antibody (Serotec) at a 1:100 dilution in 5% horse serum to detect infiltrating leukocytes (particularly T lymphocytes, monocytes and macrophages) or mouse MAb 5B4/2F2 against VV protein A27L (Czerny & Mahnel, 1990Down ) at 1:1000 dilution. Bound antibody was detected by incubation with 1:100-diluted biotinylated horse anti-mouse secondary antibody (Vector Laboratories) followed by Vectastain Elite ABC Reagent (Vector Laboratories). Immunostained sections was visualized using the chromogenic substrate diaminobenzidine tetrahydrochloride (DAB) (Sigma), which produces a reddish-brown precipitate. The sections were counterstained with cresyl violet acetate (1%), dehydrated through increasing concentrations of 70, 80, 95% and absolute ethanol, and mounted with coverslips using DPX (BDH Merck). Histological examination of these sections was done under bright field illumination using a Zeiss Axiophot photomicroscope.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The A41L protein is related to the T1/35 kDa protein family
The A41L genes from VV strains Copenhagen and WR were predicted to encode a 25 kDa protein with 219 amino acid residues (Goebel et al., 1990Down ; Howard et al., 1991Down ). Computational analyses revealed this protein was related to SFV T1 protein (Howard et al., 1991Down ), VV strain Lister vCKBP (Alcamí et al., 1998Down ) and very similar proteins from other orthopoxviruses, and orf virus GIF (Deane et al., 2000Down ). This similarity is illustrated in Fig. 1(a)Down by the alignment of the amino acid sequences of these proteins. Note the conservation of eight cysteine residues in A41L, vCKBP and SFV T1, and the similar length of these proteins. The relationship between the VV A41L protein and vCKBP is also illustrated by their similar hydropathy profiles (Fig. 1bDown) and acidic nature, pI 5·4 for A41L and 4·3 for vCKBP. Note the position of an insertion in vCKBP and the positions of the cysteine residues conserved in each protein.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 1. (a) Alignment of the amino acid sequences of the VV WR A41L protein (Smith et al., 1991Down ), vCKBP from VV Lister (Patel et al., 1990Down ), orf GIF (Deane et al., 2000Down ) and the SFV T1 protein (Upton et al., 1987Down ) created using CLUSTALW (Thompson et al., 1994Down ) and presented using GeneDoc (Nicholas et al., 1997Down ). The database accession numbers for these proteins are P24766, P19063, AAF29506 and A43692, respectively. Identical amino acid residues or those with similar properties within the alignment including conserved cysteine residues are highlighted in black; identities across three of the four sequences are highlighted in grey. (b) Hydropathy profiles of the A41L and vCKBP proteins using the PepWindow program in EGCG (Devereux et al., 1984Down ). The degrees of hydrophobicity and hydrophilicity are assigned positive or negative values, respectively. The filled circles denote the positions of the eight cysteine residues conserved in both proteins. The black area corresponds to a 27 amino acid region rich in acidic residues found in vCKBP (Glu-71 to Tyr-97) but absent from the A41L protein.

 
The A41L gene is non-essential for virus replication in cell culture
The genomes of orthopoxviruses that have been sequenced all contain a gene very similar to VV A41L suggesting that the encoded protein might have an important function. To explore this and to facilitate the characterization of the encoded protein, we attempted to make a VV deletion mutant lacking the A41L gene. The parental virus selected was the WR strain because this strain lacks the related protein vCKBP (Alcamí et al., 1998Down ) that might compensate functionally for loss of the A41L gene. Despite the conservation of A41L, a viable deletion mutant was isolated and, as a control, a revertant virus was also constructed. The genomes of these recombinant viruses were analysed by PCR and Southern blotting and were found to be as predicted (data not shown).

To investigate if loss of the A41L gene affected virus growth kinetics, BS-C-1 cells were infected with vA41L, v{Delta}A41L or vA41L-rev viruses at 0·01 p.f.u. per cell and the combined infectivity present in the cell and supernatant at different times p.i. was determined by plaque assay. No differences were seen between the viruses (Fig. 2aDown). There were also no differences between titres of the extracellular virus fraction (data not shown). The plaque morphology formed on BS-C-1 cells by each virus was also indistinguishable (Fig. 2bDown). These data indicated that despite its conservation in orthopoxviruses the A41L gene was dispensable for replication in cell culture.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. Replication of recombinant viruses in cell culture. (a) Growth curve. BS-C-1 cells were infected with vA41L, v{Delta}A41L and vA41L-rev at 0·01 p.f.u. per cell and at the indicated time-points the infected cells were scraped into the culture medium and the mixture was frozen and thawed three times and sonicated. Infectious virus titres were determined by plaque assay on fresh monolayers of BS-C-1 cells. Results are from triplicate experiments (mean±SEM). Error bars are obscured by the data points. (b) Plaque phenotype. BS-C-1 cells were infected with vA41L, v{Delta}A41L and vA41L-rev and the cells were overlaid with MEM containing 2·5% FBS and 1% carboxymethylcelluose. Cells were stained with crystal violet 2 days p.i.

 
Expression and purification of the A41L protein
The A41L protein was characterized initially by expression in recombinant baculovirus with a C-terminal addition of six histidine residues, AcA41Lhis (Methods). A similar recombinant baculovirus was made that lacked the His-tag, AcA41L. Sf21 cells were infected with AcA41Lhis, AcA41L or AcNPV, labelled with [35S]methionine and [35S]cysteine and proteins present in the supernatant were analysed by SDS–PAGE and autoradiography (Fig. 3aDown). A protein of 30 kDa was expressed by AcA41Lhis and AcA41L but not AcNPV. Immunoblot analysis showed that the protein expressed by AcA41Lhis was recognized by a MAb against the His(6) tag (Clontech) (Fig. 3bDown). The AcA41Lhis protein was then purified by Ni2+ affinity chromatography and protein fractions were analysed by SDS–PAGE and staining with Coomassie blue (Fig. 3cDown). A protein of 30 kDa eluted from the column in 60 mM imidazole. This protein was purified further by anion exchange chromatography on a MonoQ column by FPLC. The 30 kDa protein eluted in a sharp peak at 300 mM NaCl and appeared free of contaminating proteins when analysed by SDS–PAGE (data not shown). It was used for immunization of rabbits to raise a polyclonal antibody and for BIAcore 2000 surface plasmon resonance analysis.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3. Expression and purification of the A41L protein from recombinant baculovirus. (a) Autoradiography of [35S]methionine-labelled proteins. Sf21 cells were infected with AcA41Lhis, AcA41L or AcMNPV at 10 p.f.u. per cell. At 3 days p.i., the cells were labelled with [35S]methionine and [35S]cysteine for 2 h and the proteins in the culture supernatant were collected and analysed by SDS–PAGE (12% gel). (b) Immunoblot. Proteins in the supernatants of AcA41Lhis- or AcMNPV-infected Sf21 cells were resolved by SDS–PAGE (10% gel), transferred to nitrocellulose and probed with a rabbit antiserum directed against the A41L protein. (c) Coomassie-stained gel showing the purification of the A41Lhis protein by nickel-chelate affinity chromatography. Proteins present in the supernatant of AcA41Lhis-infected cells are compared to proteins present in the flow-through after application to the nickel column and to proteins eluting in increasing concentrations of imidazole. The sizes of protein molecular mass markers are shown in kDa.

 
The A41L protein is secreted from VV-infected cells
The rabbit anti-A41L antibody was used in immunoblotting to characterize the A41L protein synthesized by VV-infected cells (Fig. 4Down). A 30 kDa protein was detected in the supernatant of cells infected with WR by 2 h p.i and this increased up to 16 h. p.i. (Fig. 4aDown). The protein was also detected in the presence of araC, an inhibitor of DNA replication and late gene expression. Therefore the protein was synthesized both early and late during infection. The A41L protein had a decreased size when synthesized in the presence of either tunicamycin or monensin and therefore contains both N- and O-linked carbohydrate (Fig. 4bDown). To investigate if the A41L protein was associated with virus particles, intracellular mature virus (IMV) or extracellular enveloped virus (EEV) were purified from HeLa cells infected with VV WR and analysed by immunoblot alongside protein in the supernatant from infected cells (Fig. 4cDown). The A41L protein was not found with either virion preparation, but was detected in the cell supernatant. In contrast, the IMV 14 kDa protein was detected in both IMV and EEV samples, and the EEV B5R glycoprotein was detected only in EEV.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 4. Immunoblots showing the A41L protein made by VV WR. (a) The A41L protein is made early and late during infection. BS-C-1 cells were mock-infected or infected with VV WR at 10 p.f.u. per cell in the presence or absence of 40 µg/ml araC and proteins in the supernatants at the indicated times p.i. were separated by SDS–PAGE (10% gel) and transferred to nitrocellulose. Blots were incubated with rabbit antiserum raised against the A41L protein and bound antibody was detected as described in Methods. (b) The A41L protein contains N- and O-linked carbohydrate. Cells were infected with WR virus in the presence or absence of monensin (1 µM) or tunicamycin (1 µg/ml) for 16 h. Supernatants were prepared and analysed as in (a). (c) The A41L protein is not associated with IMV and EEV. Purified IMV or EEV (1 µg) or the proteins in the supernatant from 104 HeLa cells infected with VV WR for 16 h were analysed by SDS–PAGE and immunoblot as described in (a). Antibodies used were either the rabbit anti-A41L, MAb 5B4 against the A27L gene product, or a rabbit antiserum against the B5R protein. The sizes of protein molecular mass markers are indicated in kDa.

 
The A41L protein is conserved in orthopoxviruses
Orthopoxvirus DNA sequence data show that the A41L gene is highly conserved (Introduction). To examine if the protein is expressed by different orthopoxviruses, supernatants from cells infected with 16 strains of VV and 2 strains of cowpox virus were analysed by immunoblotting (Fig. 5Down). All these viruses express a protein of similar size that is recognized by the anti-A41L antibody. As a control, cells were also infected with the v{Delta}A41L mutant, and the failure to detect the A41L protein in this case confirmed the specificity of the antibody.



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 5. The A41L protein is conserved in orthopoxviruses. BS-C-1 cells were infected with the indicated viruses or mock-infected and proteins in the supernatants at 16 h p.i. were immunoblotted with the A41L protein as described in Fig. 4Up. Protein molecular mass markers are indicated in kDa.

 
Deletion of A41L increases immunopathology but enhances virus clearance in an intradermal mouse model of infection
A mouse intradermal model was used to examine the role of A41L in vivo. Groups of five mice were infected with 106 p.f.u. of vA41L, v{Delta}A41L or vA41L-rev and the diameter of lesions on infected ears was estimated daily with the aid of a micrometer (Fig. 6aDown). Lesions appeared first at 5 days p.i. irrespective of the virus used, but at all times the average lesion size for mice infected with v{Delta}A41L was larger than for the wild-type and revertant viruses. On days 6 to 11 inclusive, this difference in lesion size between v{Delta}A41L and the other two viruses was statistically significant (P<0·001). This result was confirmed in a second experiment (data not shown). The enhanced lesion size in mice infected with v{Delta}A41L might have been due to increased virus growth or immunopathology. To distinguish between these possibilities, a third experiment was performed in which infectious virus was measured. Groups of 12 mice were infected with 104 p.f.u. of vA41L, v{Delta}A41L or vA41L-rev in the left and right ears. Lesion sizes were measured daily (Fig. 6bDown) and the titre of infectious virus in the ears of two mice infected with each virus was quantified on days 3, 6, 8, 10, 12 and 14. Again, deleting A41L from VV WR increased the lesion size after intradermal inoculation. The virus infectivity measurements showed that each virus replicated to a similar titre in the infected ears but, despite having larger lesion sizes, mice infected with v{Delta}A41L cleared the virus from infected skin more rapidly than controls (P=0·03 on days 10 and 12 p.i.). Another experiment measuring virus in ear pinnae confirmed this result and again there was a significant difference (P=0·02 on day 10) between mutant and control viruses (data not shown).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 6. (a) Groups of five BALB/c mice were infected intradermally in the ear pinnae with 106 p.f.u. of either vA41L, v{Delta}A41L or vA41L-rev viruses. Sizes of lesions were estimated with the aid of a micrometer and scored to the nearest mm. The mean lesion size in each group±SEM is shown. P-values (P<0·001) determined using Student’s t-test are indicated. (b, c) The ear pinnae of groups of 12 BALB/c mice were infected intradermally with 3x103 p.f.u. of either vA41L, v{Delta}A41L or vA41L-rev viruses. (b) Sizes of lesions in both ears were estimated daily with the aid of a micrometer and scored to the nearest 0·5 mm. The mean lesion size in each group±SEM is shown. P-values (P<0·001; days 6 to 12) were determined using Student’s t-test. (c) Two mice per group were sacrificed at days 3, 6, 8, 10, 12 and 14. Both ears were removed, ground, freeze–thawed, sonicated and the virus titres determined by plaque assay on BS-C-1 cells. P-values (P<0·03; days 10 and 12) were determined using Student’s t-test.

 
The A41L protein inhibits infiltration of cells into infected rabbit skin
The outcome of infection in an additional in vivo dermal model was investigated. Viruses vA41L, v{Delta}A41L and vA41L-rev were injected subcutaneously into rabbit skin and the lesions were examined 3 days later (Fig. 7Down). Although differences in lesion size were not apparent, histologically there were differences in cellular infiltration and viral antigen between lesions induced by v{Delta}A41L and control viruses. Immunostaining of lesions infected with v{Delta}A41L using anti-rabbit CD43 antibody revealed intense infiltration of CD43+ cells (stained reddish-brown, Fig. 7Down) in the lower vascular regions of the skin, as compared to that of vA41L and vA41L-rev, which exhibited fewer infiltrating cells. The amount of VV A27L antigen present in the dermis and epidermis (stained reddish-brown, Fig. 7Down) was greater in lesions caused by vA41L and vA41L-rev than that of v{Delta}A41L. This demonstrates that the A41L protein could reduce the infiltration of CD43+ cells into infected lesions and, presumably as a consequence of the greater infiltration in v{Delta}A41L-infected cells, the amount of virus antigen detected was reduced.



View larger version (168K):
[in this window]
[in a new window]
 
Fig. 7. Histological examination showing differences in cellular infiltration and virus antigen through the vascularized lower dermis of the rabbit skin. Biopsy tissue samples from lesions were taken 3 days after injection of 104 p.f.u. of vA41L, v{Delta}A41L and vA41L-rev. These cryosections (10 µm) were immunostained (Methods) for infiltrating CD43+ leukocytes using a mouse anti-rabbit CD43 antibody (diluted 1:100) (Serotec) or for VV A27L antigen using a mouse MAb 5B4/2F2 (diluted 1:1000) (Czerny & Mahnel, 1990Down ). Bound antibody was detected with a biotinylated anti-mouse secondary antibody (diluted 1:100) (Vector Laboratories) and visualized with the chromogenic substrate diaminobenzidine tetrahydrochloride (DAB) (Sigma) giving the reddish-brown stain. Cell nuclei were counterstained (deep blue) with cresyl violet acetate. Photographs of the immunostained sections were taken with a Zeiss Axiophot photomicroscope under bright field illumination at magnification x100.

 
Binding properties of the A41L protein
The in vivo observations above, together with the similarity of the A41L protein to vCKBP, suggested that A41L might regulate leukocyte infiltration by binding and inhibiting chemokines. However, supernatants from VV WR-infected cells had been shown not to contain a protein that bound the human CC chemokines MIP-1{alpha} or RANTES, or the human CXC chemokines GRO-{alpha} and IL-8 (Alcamí et al., 1998Down ). To determine if the A41L protein bound to other chemokines that were not included in that study, a surface plasmon resonance sensor was used to measure binding of recombinant chemoattractant molecules to the immobilized protein ligands. Proteins used in these studies were (i) purified A41Lhis and vCKBPhis, (ii) A41L and vCKBP expressed and purified from Picia pastoris supernatants, and (iii) supernatants containing A41L-Fc or vCKBP-Fc fusions. The Fc fusion proteins were captured by anti-Fc antibodies immobilized to the biosensor chip, whilst the other proteins were coupled directly to biosensor chips.

As expected, many CC chemokines (human PARC, MIP-1{alpha}, MIP-1{beta}, eotaxin, LEC, TARC, RANTES, MCP-2, MCP-3; mouse eotaxin, MIP-1{alpha}, MIP-1{gamma}, MCP-1, MCP-2) gave positive signals with vCKBP compared to A41L (data not shown), confirming they bound to vCKBP but not A41L. With the CXC chemokines IL-8, NAP-2, GRO-{alpha}, GRO-{gamma} and SDF-1 no specific binding was observed to either vCKBP or A41L. In some experiments IP-10, ITAC and MIG showed some weak binding to A41L; however, A41L-his was unable to block the migration of cells expressing CXCR3 in response to these chemokines (data not shown). Other chemoattractant molecules tested – anaphylatoxin C5a and the cytokines IL-2, IL-3, IL-4, GM-CSF and SCF – were not bound by A41L (data not shown).


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
VV and other poxviruses secrete several proteins from infected cells that interfere with specific components of the immune system. Here we have characterized the VV A41L protein because bioinformatic analyses show that it is related to other poxvirus proteins that are secreted from the infected cells and bind either CC chemokines or GM-CSF and IL-2. Data presented show that the A41L protein is conserved among orthopoxviruses, is non-essential for virus replication in cell culture but has an immunomodulatory role in dermal models of infection. The nature of the ligand(s) bound by A41L were sought using surface plasmon resonance but were not identified.

The A41L gene is expressed early and late during infection, a pattern of gene expression that matches that of the related protein vCKBP (Alcamí et al., 1998Down ), which is driven by the p7·5K promoter from VV strain WR that has been widely used in recombinant VV expression vectors (Mackett & Smith, 1982Down ). The A41L protein is modified by addition of N- and O-linked carbohydrate, but is still secreted from infected cells in the absence of either type of glycosylation. All orthopoxviruses tested (16 strains of VV and 2 strains of cowpox virus) expressed a soluble A41L protein and in addition the gene is highly conserved in other sequenced orthopoxviruses including several strains of variola virus and camelpox virus. Despite this conservation an A41L-deletion mutant replicated normally in cell culture.

The importance of the A41L protein was demonstrated in vivo using two different models. In a mouse intradermal model the deletion mutant induced larger lesions than wild-type and revertant controls. This was not due to differences in virus replication, since in all cases the titre of virus detectable in the ears after infection increased at the same rate and reached the same maximum titre. However, after infection with the deletion mutant, the rate at which virus was cleared was increased compared to controls. A plausible explanation is that in the absence of A41L protein, inflammatory infiltrates were increased or altered in cellular composition such that they caused more tissue damage and reduced persistence of infectious virus. Whether the reduced virus titres at late times in mice infected with v{Delta}A41L were due to the direct action of the altered infiltrate, as opposed to a loss of infectable sites, enhanced virus shedding or other indirect mechanisms, remains to be shown. Further evidence that the A41L protein alters the nature of inflammatory infiltrates came from histological examination of lesions produced by wild-type, deletion and revertant viruses in a rabbit skin model. In these infected tissues there was a greater influx of CD43+ cells after infection by the deletion mutant. Moreover, with this virus the level of virus antigen was reduced at 3 days p.i. compared to controls. In contrast to the effects of the A41L protein on dermal infections, the loss of the gene did not affect the outcome of infection in an intranasal model of infection (data not shown).

The phenotype of the deletion mutant in vivo indicated that the A41L protein was having a profound affect in restricting the infiltration of at least one type of inflammatory cells into the infected lesion. Such a phenotype was consistent with the A41L protein binding and inhibiting some pro-inflammatory factor such as a chemokine or cytokine. The amino acid similarity of A41L to the VV vCKBP and the orf virus GIF protein that binds IL-2 and GM-CSF is consistent with such a view. We therefore produced recombinant A41L protein from different expression systems, coupled these proteins to the BIAcore sensor chip and sought ligands for the A41L protein using surface plasmon resonance. However, we were unsuccessful in identifying a ligand that A41L could inhibit in biological assays. As a control we used the VV vCKBP that had been expressed in the same expression systems and showed that this bound to a variety of CC chemokines as expected. The failure to identify a ligand in this way might have been due to the recombinant proteins made from baculovirus, Pichia pastoris and as an Fc-fusion protein in mammalian cells each being inactive. We consider this unlikely since the same expression systems produced biologically active vCKBP, which has a similar size, charge and overall topology to A41L. Nonetheless without a positive control for A41L binding we cannot rule out this possibility.

The A41L protein lacks a region of vCKBP that is acidic (Fig. 1bUp) and is exposed as an external loop in the 3-dimensional structure of the related cowpox virus protein (Carfí et al., 1999Down ). To determine if this region was responsible for chemokine binding by vCKBP we transferred the extra sequences into the corresponding region of A41L. However, the recombinant A41L protein was unable to bind CC chemokines (data not shown).

To continue the search for the ligand(s) for A41L we propose to undertake more detailed histological examination of infected tissue to determine what subsets of infected cells are recruited in the absence of A41L and are present when A41L has been deleted. In addition, it is possible that rather than binding a soluble factor, A41L binds to a host ligand present on a cell surface. There are precedents for soluble VV proteins binding to cells to mediate their biological function. For instance, the VV semaphorin encoded by VV gene A39R binds to the cell surface receptor plexin-1 (Comeau et al., 1998Down ), the VV WR B18R protein binds to an unidentified cell surface molecule and is able to bind type I interferons in solution and at the cell surface (Alcamí et al., 2000Down ), and a tumour necrosis factor receptor encoded by the Lister, Evans and USSR strains of VV is able to bind to the cell surface where it can bind TNF (Alcamí et al., 1999Down ).

Lastly, the profound anti-inflammatory effects that A41L mediates in vivo suggest that the protein might have therapeutic application as an anti-inflammatory for acute conditions, and that the protein might reduce immune responses following infection by viruses. Therefore, the deletion of A41L from candidate poxvirus vaccines such as MVA might be beneficial in stimulating an immune response.

In summary, the A41L protein is shown to be another soluble immunomodulator secreted from VV-infected cells, but its ligand(s) has yet to be identified.


   Acknowledgments
 
This work has been supported by The Wellcome Trust programme grant 037575/Z/93/1.27. A.N. was the recipient of Wellcome Trust Prize Research Studentship, D.C.T. was a Wellcome Trust Travelling Research Fellow, G.L.S is a Wellcome Trust Principal Research Fellow and P.R. is a Howard Florey Research Fellow of The Royal Society. We thank Liz Darley for technical assistance with immunohistochemistry and Tim Wells and Amanda Proudfoot (Serono, Geneva) for provision of cytokines.


   Footnotes
 
b Present address: The National Cancer Centre, 11 Hospital Drive, Singapore 169610, Republic of Singapore. Back

c Present address: Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20852, USA. Back

d Present address: The Wright–Fleming Institute, Imperial College, School of Medicine, St Mary’s Campus, Norfolk Place, London W2 1PG, UK. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Aguado, B., Selmes, I. P. & Smith, G. L. (1992). Nucleotide sequence of 21·8 kbp of variola major virus strain Harvey and comparison with vaccinia virus. Journal of General Virology 73, 2887-2902.[Abstract/Free Full Text]

Alcamí, A. & Kosinowski, U. (2000). Viral immune evasion strategies. Immunology Today 21, 447-455.[Medline]

Alcamí, A. & Smith, G. L. (1995). Vaccinia, cowpox, and camelpox viruses encode soluble gamma interferon receptors with novel broad species specificity. Journal of Virology 69, 4633-4639.[Abstract]

Alcamí, A., Symons, J. A., Collins, P. D., Williams, T. J. & Smith, G. L. (1998). Blockade of chemokine activity by a soluble chemokine binding protein from vaccinia virus. Journal of Immunology 160, 624-633.[Abstract/Free Full Text]

Alcamí, A., Khanna, A., Paul, N. L. & Smith, G. L. (1999). Vaccinia virus strains Lister, USSR and Evans express soluble and cell surface tumour necrosis factors receptor. Journal of General Virology 80, 949-959.[Abstract]

Alcamí, A., Symons, J. A. & Smith, G. L. (2000). The vaccinia soluble IFN-{alpha}/{beta} receptor binds to the cell surface and protects cells from the anti-viral effects of IFN. Journal of Virology 74, 11230-11239.[Abstract/Free Full Text]

Antoine, G., Scheiflinger, F., Dorner, F. & Falkner, F. G. (1998). The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244, 365-396.[Medline]

Boyle, D. B. & Coupar, B. E. H. (1988). A dominant selectable marker for the construction of recombinant poxviruses. Gene 65, 123-128.[Medline]

Carfí, A., Smith, C. A., Smolak, P. J., McGrew, J. & Wiley, D. C. (1999). Structure of a soluble secreted chemokine inhibitor vCCI (p35) from cowpox virus. Proceedings of the National Academy of Sciences, USA 96, 12379-12383.[Abstract/Free Full Text]

Comeau, M. R., Johnson, R., DuBose, R. F., Petersen, M., Gearing, P., VandenBos, T., Park, L., Farrah, T., Buller, R. M., Cohen, J. I., Strockbine, L. D., Rauch, C. & Spriggs, M. K. (1998). A poxvirus-encoded semaphorin induces cytokine production from monocytes and binds to a novel cellular semaphorin receptor, VESPR. Immunity 8, 473-482.[Medline]

Czerny, C. P. & Mahnel, H. (1990). Structural and functional analysis of orthopoxvirus epitopes with neutralizing monoclonal antibodies. Journal of General Virology 71, 2341-2352.[Abstract/Free Full Text]

Deane, D., McInnes, C., Percival, A., Wood, A., Thomson, J., Lear, A., Gilray, J., Fleming, S., Mercer, A. & Haig, D. (2000). Orf virus encodes a novel secreted protein inhibitor of granulocyte-macrophage colony-stimulating factor and interleukin-2. Journal of Virology 74, 1313-1320.[Abstract/Free Full Text]

Devereux, J., Haeberli, P. & Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, 387-395.

Falkner, F. G. & Moss, B. (1988). Escherichia coli gpt gene provides dominant selection for vaccinia virus open reading frame expression vectors. Journal of Virology 62, 1849-1854.[Abstract/Free Full Text]

Falkner, F. G. & Moss, B. (1990). Transient dominant selection of recombinant vaccinia viruses. Journal of Virology 64, 3108-3111.[Abstract/Free Full Text]

Fenner, F., Anderson, D. A., Arita, I., Jezek, Z. & Ladnyi, I. D. (1988). Smallpox and its Eradication. Geneva: World Health Organization.

Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P. & Paoletti, E. (1990). The complete DNA sequence of vaccinia virus. Virology 179, 247-266.[Medline]

Graham, K. A., Lalani, A. S., Macen, J. L., Ness, T. L., Barry, M., Liu, L., Lucas, A., Clark-Lewis, I., Moyer, R. W. & McFadden, G. (1997). The T1/35kDa family of poxvirus-secreted proteins bind chemokines and modulate leukocyte influx into virus-infected tissues. Virology 229, 12-24.[Medline]

Howard, S. T., Chan, Y. S. & Smith, G. L. (1991). Vaccinia virus homologues of the Shope fibroma virus inverted terminal repeat proteins and a discontinuous ORF related to the tumor necrosis factor receptor family. Virology 180, 633-647.[Medline]

Hughes, S. J., Johnston, L. H., de Carlos, A. & Smith, G. L. (1991). Vaccinia virus encodes an active thymidylate kinase that complements a cdc8 mutant of Saccharomyces cerevisiae. Journal of Biological Chemistry 266, 20103-20109.[Abstract/Free Full Text]

Johnson, G. P., Goebel, S. J. & Paoletti, E. (1993). An update on the vaccinia virus genome. Virology 196, 381-401.[Medline]

Kerr, S. M. & Smith, G. L. (1991). Vaccinia virus DNA ligase is nonessential for virus replication: recovery of plasmids from virus-infected cells. Virology 180, 625-632.[Medline]

Mackett, M. & Smith, G. L. (1982). Vaccinia virus: a selectable eukaryotic cloning and expression vector. Proceedings of the National Academy of Sciences, USA 79, 7415-7419.[Abstract/Free Full Text]

Mackett, M., Smith, G. L. & Moss, B. (1985). The construction and characterization of vaccinia virus recombinants expressing foreign genes. In DNA Cloning: A Practical Approach , pp. 191-211. Edited by D. M. Glover. Oxford:IRL Press.

Massung, R. F., Liu, L., Qi, J., Knight, J. C., Yuran, T. E., Kerlavage, A. R., Parsons, J. M., Venter, J. C. & Esposito, J. J. (1994). Analysis of the complete genome of smallpox variola major virus strain Bangladesh-1975. Virology 201, 215-240.[Medline]

Moss, B. (1996). Poxviridae: the viruses and their replication. In Fields Virology , pp. 2637-2671. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Nicholas, K. B., Nicholas, H. B.Jr. & Deerfield, D. W.II (1997). GeneDoc: analysis and visualization of genetic variation. EMBNEW NEWS 4, 14.

Parkinson, J. E. & Smith, G. L. (1994). Vaccinia virus gene A36R encodes a Mr 43–50 K protein on the surface of extracellular enveloped virus. Virology 204, 376-390.[Medline]

Patel, A. H., Gaffney, D. F., Subak-Sharpe, J. H. & Stow, N. D. (1990). DNA sequence of the gene encoding a major secreted protein of vaccinia virus, strain Lister. Journal of General Virology 71, 2013-2021.[Abstract/Free Full Text]

Shchelkunov, S. N., Blinov, V. M., Resenchuk, S. M., Totmenin, A. V., Olenina, L. V., Chirikova, G. B. & Sandakhchiev, L. S. (1994). Analysis of the nucleotide sequence of 53 kbp from the right terminus of the genome of variola virus strain India-1967. Virus Research 34, 207-236.[Medline]

Smith, G. L., Chan, Y. S. & Howard, S. T. (1991). Nucleotide sequence of 42 kbp of vaccinia virus strain WR from near the right inverted terminal repeat. Journal of General Virology 72, 1349-1376.[Abstract/Free Full Text]

Smith, C. A., Smith, T. D., Smolak, P. J., Friend, D., Hagen, H., Gerhart, M., Park, L., Pickup, D. J., Torrance, D., Mohler, K., Schooley, K. & Goodwin, R. G. (1997). Poxvirus genomes encode a secreted, soluble protein that preferentially inhibits {beta} chemokine activity yet lacks sequence homology to known chemokine receptors. Virology 236, 316-327.[Medline]

Smith, G. L., Symons, J. A., Khanna, A., Vanderplasschen, A. & Alcamí, A. (1997). Vaccinia virus immune evasion. Immunological Reviews 159, 137-154.[Medline]

Spriggs, M. K. (1996). One step ahead of the game: viral immunomodulatory molecules. Annual Review of Immunology 14, 101-130.[Medline]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.[Abstract/Free Full Text]

Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences, USA 76, 4350-4354.[Abstract/Free Full Text]

Tscharke, D. C. & Smith, G. L. (1999). A model for vaccinia virus pathogenesis and immunity based on intradermal injection of mouse ear pinnae. Journal of General Virology 80, 2751-2755.[Abstract/Free Full Text]

Upton, C., DeLange, A. M. & McFadden, G. (1987). Tumorigenic poxviruses: genomic organization and DNA sequence of the telomeric region of the Shope fibroma virus genome. Virology 160, 20-30.[Medline]

Received 1 May 2001; accepted 14 June 2001.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
A. S. Fahy, R. H. Clark, E. F. Glyde, and G. L. Smith
Vaccinia virus protein C16 acts intracellularly to modulate the host response and promote virulence
J. Gen. Virol., October 1, 2008; 89(10): 2377 - 2387.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Assarsson, J. A. Greenbaum, M. Sundstrom, L. Schaffer, J. A. Hammond, V. Pasquetto, C. Oseroff, R. C. Hendrickson, E. J. Lefkowitz, D. C. Tscharke, et al.
Kinetic analysis of a complete poxvirus transcriptome reveals an immediate-early class of genes
PNAS, February 12, 2008; 105(6): 2140 - 2145.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. B. Ruiz-Arguello, V. P. Smith, G. S. V. Campanella, F. Baleux, F. Arenzana-Seisdedos, A. D. Luster, and A. Alcami
An Ectromelia Virus Protein That Interacts with Chemokines through Their Glycosaminoglycan Binding Domain
J. Virol., January 15, 2008; 82(2): 917 - 926.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. de Turenne-Tessier and T. Ooka
Post-translational modifications of Epstein Barr virus BARF1 oncogene-encoded polypeptide
J. Gen. Virol., October 1, 2007; 88(10): 2656 - 2661.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. L. Arnold and D. H. Fremont
Structural determinants of chemokine binding by an ectromelia virus-encoded decoy receptor.
J. Virol., August 1, 2006; 80(15): 7439 - 7449.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. L. Afonso, E. R. Tulman, G. Delhon, Z. Lu, G. J. Viljoen, D. B. Wallace, G. F. Kutish, and D. L. Rock
Genome of crocodilepox virus.
J. Virol., May 1, 2006; 80(10): 4978 - 4991.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
R. H. Clark, J. C. Kenyon, N. W. Bartlett, D. C. Tscharke, and G. L. Smith
Deletion of gene A41L enhances vaccinia virus immunogenicity and vaccine efficacy
J. Gen. Virol., January 1, 2006; 87(1): 29 - 38.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. J. Esteban and R. M. L. Buller
Ectromelia virus: the causative agent of mousepox
J. Gen. Virol., October 1, 2005; 86(10): 2645 - 2659.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. J. McInnes, D. Deane, D. Haig, A. Percival, J. Thomson, and A. R. Wood
Glycosylation, Disulfide Bond Formation, and the Presence of a WSXWS-Like Motif in the Orf Virus GIF Protein Are Critical for Maintaining the Integrity of Binding to Ovine Granulocyte-Macrophage Colony-Stimulating Factor and Interleukin-2
J. Virol., September 1, 2005; 79(17): 11205 - 11213.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. W. Bartlett, L. Dumoutier, J.-C. Renauld, S. V. Kotenko, C. E. McVey, H.-J. Lee, and G. L. Smith
A new member of the interleukin 10-related cytokine family encoded by a poxvirus
J. Gen. Virol., June 1, 2004; 85(6): 1401 - 1412.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. T. Seet, C. A. McCaughan, T. M. Handel, A. Mercer, C. Brunetti, G. McFadden, and S. B. Fleming
Analysis of an orf virus chemokine-binding protein: Shifting ligand specificities among a family of poxvirus viroceptors
PNAS, December 9, 2003; 100(25): 15137 - 15142.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. S. Broyles
Vaccinia virus transcription
J. Gen. Virol., September 1, 2003; 84(9): 2293 - 2303.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Pires de Miranda, P. C. Reading, D. C. Tscharke, B. J. Murphy, and G. L. Smith
The vaccinia virus kelch-like protein C2L affects calcium-independent adhesion to the extracellular matrix and inflammation in a murine intradermal model
J. Gen. Virol., September 1, 2003; 84(9): 2459 - 2471.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. C. Reading, J. A. Symons, and G. L. Smith
A Soluble Chemokine-Binding Protein from Vaccinia Virus Reduces Virus Virulence and the Inflammatory Response to Infection
J. Immunol., February 1, 2003; 170(3): 1435 - 1442.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. A. Symons, E. Adams, D. C. Tscharke, P. C. Reading, H. Waldmann, and G. L. Smith
The vaccinia virus C12L protein inhibits mouse IL-18 and promotes virus virulence in the murine intranasal model
J. Gen. Virol., November 1, 2002; 83(11): 2833 - 2844.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. A. Symons, D. C. Tscharke, N. Price, and G. L. Smith
A study of the vaccinia virus interferon-{gamma} receptor and its contribution to virus virulence
J. Gen. Virol., August 1, 2002; 83(8): 1953 - 1964.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. Bartlett, J. A. Symons, D. C. Tscharke, and G. L. Smith
The vaccinia virus N1L protein is an intracellular homodimer that promotes virulence
J. Gen. Virol., August 1, 2002; 83(8): 1965 - 1976.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. C. Tscharke, P. C. Reading, and G. L. Smith
Dermal infection with vaccinia virus reveals roles for virus proteins not seen using other inoculation routes
J. Gen. Virol., August 1, 2002; 83(8): 1977 - 1986.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. Gubser and G. L. Smith
The sequence of camelpox virus shows it is most closely related to variola virus, the cause of smallpox
J. Gen. Virol., April 1, 2002; 83(4): 855 - 872.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. D. Gardner, D. C. Tscharke, P. C. Reading, and G. L. Smith
Vaccinia virus semaphorin A39R is a 50-55 kDa secreted glycoprotein that affects the outcome of infection in a murine intradermal model
J. Gen. Virol., September 1, 2001; 82(9): 2083 - 2093.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ng, A.
Right arrow Articles by Smith, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ng, A.
Right arrow Articles by Smith, G. L.
Agricola
Right arrow Articles by Ng, A.
Right arrow Articles by Smith, G. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS