J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamauchi, Y.
Right arrow Articles by Nishiyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamauchi, Y.
Right arrow Articles by Nishiyama, Y.
Agricola
Right arrow Articles by Yamauchi, Y.
Right arrow Articles by Nishiyama, Y.
Journal of General Virology (2001), 82, 1423-1428.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Herpes simplex virus type 2 UL34 protein requires UL31 protein for its relocation to the internal nuclear membrane in transfected cells

Y. Yamauchi1, C. Shiba1, F. Goshima1, A. Nawa1, T. Murata1 and Y. Nishiyama1

Laboratory of Virology, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Tsurumai-cho 65, Showa-ku, Nagoya 466-8550, Japan1

Author for correspondence: Yukihiro Nishiyama. Fax +81 52 744 2452. e-mail ynishiya{at}tsuru.med.nagoya-u.ac.jp


   Abstract
TOP
Abstract
Main text
References
 
Herpes simplex virus type 2 UL34 protein is expressed late in infection and is required for envelopment of nucleocapsids at the nuclear membrane and possibly at the endoplasmic reticulum (ER). It is a type II membrane protein with a C-terminal anchor that localizes mainly to the nuclear membrane in infected cells. However, in single transient expression, UL34 protein localizes predominantly to the ER. Relocation of UL34 protein from the ER to the internal nuclear membrane and the nucleus was observed in the presence of UL31 protein, a phosphoprotein known to interact physically with UL34. It is suggested here that interaction with UL31 protein is important for the nuclear targetting of UL34 protein and also that the trans-membrane region of UL34 protein is responsible for its localization at the internal nuclear membrane. The results also suggest possible sites for the interaction.


   Main text
TOP
Abstract
Main text
References
 
Herpes simplex virus (HSV) is an enveloped DNA virus that encodes at least 74 different genes (Roizman & Sears, 1996Down ; Dolan et al., 1998Down ). Approximately 40 of them, named core genes, are conserved in all families of herpesviruses (McGeoch, 1992Down ). The UL34 gene homologues of HSV types 1 and 2 (HSV-1 and HSV-2) can be found in alpha-, beta- and gammaherpesviruses, and all these products contain a hydrophobic stretch of 22–37 residues near the C terminus (Davison & Scott, 1986Down ; Chee et al., 1990Down ; Gompels et al., 1995Down ; Nicholas, 1996Down ; Baer et al., 1984Down ; Roizman & Sears, 1996Down ; Dolan et al., 1998Down ). Egress of HSV-1 capsids from the nucleus has been found to require UL34 protein (Roller et al., 2000Down ), which is a C-terminally anchored type II membrane protein, phosphorylated either directly or indirectly by the US3 protein kinase (Purves et al., 1991Down , 1992Down ; Daikoku et al., 1993Down , 1994Down ; Shiba et al., 2000Down ), transcription of which is also regulated by the US11 protein (Roller & Roizman, 1991Down ). The UL34 gene product of HSV-2 is identified as proteins with molecular masses of 31 and 32·5 kDa, the latter being the phosphorylated form and more submissive to proteinase digestion. This implies a functional or structural change resulting from phosphorylation (Shiba et al., 2000Down ). UL34 protein is detected in mature HSV-1 virions and has been proposed to interact with cytoplasmic dynein during virus entry, which should target incoming capsids to the nuclear membrane (Ye et al., 2000Down ).

The UL31 gene is also one of the core genes, and the gene product of HSV is a largely insoluble, evenly dispersed nuclear phosphoprotein that co-fractionates with the nuclear matrix and is required for optimal processing and packaging of viral DNA into pre-formed capsids (Chang & Roizman, 1993Down ; Yamada et al., 1998Down ). Its nuclear distribution changes little during the course of infection and localization in transient expression assays is also nuclear (Zhu et al., 1999Down ). Recently, the UL31 protein of HSV-1 has been found to depend on physical interaction with UL34 protein for its stabilization in infected cells (Ye & Roizman, 2000Down ).

When expressed transiently, the C-terminal anchor of UL34 protein localizes the protein mainly to the endoplasmic reticulum (ER) and the nuclear membrane, orientating the N terminus in the cytoplasm (Shiba et al., 2000Down ), which raises the question of how the primarily ER-associated fraction of the expressed protein localizes predominantly to the nuclear membrane, as in infection. One suggestion is that another virus protein is required.

In this study, we examined the effects of co-expression of UL31 and UL34 proteins on their intracellular localization in transfection assays. We found that the co-expression of UL31 protein was necessary for UL34 protein to localize predominantly to the nucleus and especially to the internal nuclear membrane. Furthermore, various deletion mutants of both proteins were co-expressed to estimate the regions required for each translocation step, (i) UL34 protein nuclear targetting and (ii) internal nuclear membrane targetting. The results suggest that the N terminus of UL34 and the C-terminal two-thirds of UL31 are possible sites for the interaction.

Plasmids expressing wild-type (wt) and various deletion mutants of UL34 and UL31 proteins were singly transfected with the Lipofectamine reagent (Gibco BRL) onto monolayers of Vero cells grown on coverslips. After 24 h, the cells were washed in PBS and fixed in cold acetone with the exception of GFP-expressing cells, which were fixed in PBS containing 4% formaldehyde. Cells were then analysed by indirect immunofluorescence with a laser scanning confocal microscope. Construction of and expression from plasmids pcDNA3-UL34, -UL34MC{Delta}256/276, -UL34MN{Delta}2/38, UL31, UL31MN3{Delta}1/110, UL31MC2{Delta}215/305 and UL31MN3{Delta}1/110-GFP has been described previously (Zhu et al., 1999Down ; Shiba et al., 2000Down ). The monoclonal mouse anti-lamin B1 antibody was obtained from ZYMED.

pcDNA3-UL34, pcDNA3-UL34MC{Delta}256/276 or pcDNA3-UL34MN{Delta}2/38 DNA was transfected onto Vero cells and detected after 24 h. UL34 protein showed a predominant ER pattern with nuclear membrane localization (Fig. 1bDown, field-view image in g). UL34MC{Delta}256/276 showed dispersed localization throughout the cell but did not localize specifically to the nuclear membrane or the ER (Fig. 1cDown). This was thought to be due to the loss of 21 amino acids in the hydrophobic region of the C terminus. UL34MN{Delta}2/38, in contrast, showed similar staining to that of the wild-type protein (Fig. 1dDown).



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 1. Laser scanning confocal microscope images of the products of various transfected plasmids. Transfected Vero cells were fixed and observed 24 h later. (a)–(d) Mock-transfected cells (a) or cells transfected with pcDNA3-UL34 (b), pcDNA3-UL34MC{Delta}256/276 (c) or pcDNA3-UL34MN{Delta}2/38 (d), detected with anti-UL34 antibody. (e) A field view of cells transfected with pFLAG-UL31, detected with anti-FLAG antibody. (f) A cell transfected with UL31MN3{Delta}1/110-GFP. (g)–(h) Field views of cells transfected with pcDNA3-UL34 (g) or pcDNA3-UL34 and UL31 (h), both detected with anti-UL34.

 
The UL31 ORF is located between nucleotide positions 66932 and 67849 of the HSV-2 genome. pFLAG-UL31, which expresses a FLAG-tagged HSV-2 UL31 protein, was constructed by using primers UL31F (5' TACAAAGCTTATGTATGACATCGCCCCCCG 3'; HindIII site in italics and initiation codon in bold) and UL31R (5' TACAGGATCCCGGCGGAGGAAACTCGT 3', BamHI site in italics). pFLAG-UL31 was transfected to observe the localization of UL31 protein and showed localization in the nucleus and nucleolus but not the nuclear membrane (Fig. 1eUp). Singly expressed UL31MN3{Delta}1/110-GFP showed diffuse intracellular localization and formed clusters in some places (Fig. 1fUp).

In order to examine the effect of co-expressing UL34wt and UL31wt proteins, pcDNA3-UL34 and UL31 were transfected and detected after 24 h. In these co-transfected cells, the localization of UL34 protein was greatly altered: UL34 protein was predominantly nuclear and localized at what seemed to be the internal nuclear membrane (Fig. 1hUp).

To determine the localization of UL31wt protein, pcDNA3-UL34 and pFLAG-UL31 were co-transfected and double stained (Fig. 2aDowncDown). As expected, the proteins showed co-localization in the nucleus and especially the nuclear membrane. Furthermore, double staining of UL34 protein with lamin B1, a component of the internal nuclear membrane, showed clear co-localization (Fig. 2dDownfDown). Thus, UL34 protein was found to be localized predominantly in the internal nuclear membrane when co-expressed with UL31. In the same fashion, UL34 mutant proteins were co-expressed with UL31wt protein (Fig. 2gDownlDown). Interestingly, in co-expressing cells, UL34MC{Delta}256/276 was located in the nucleus and nucleolus in co-localization with UL31 protein but excluded from the nuclear membrane (Fig. 2gDowniDown). On the other hand, UL34MN{Delta}2/38 was predominantly cytoplasmic and localized at the ER, but localization of UL31 protein was identical to its singly expressed state (Fig. 2jDownlDown), suggesting that UL31 did not influence the N-terminally truncated UL34 protein.



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 2. Co-expression of versions of UL31 and UL34 proteins shows various targetting patterns. (a)–(c) A cell expressing UL31wt-FLAG and UL34wt proteins, showing co-localization in the nucleus. Localization at the internal nuclear membrane is emphasized by closed arrowheads (b). (d)–(f) Such cells were also detected with anti-UL34 antibody and anti-lamin B1 monoclonal antibody and showed co-localization at the internal nuclear membrane. (g)–(i) A cell co-expressing UL31wt-FLAG and UL34MC{Delta}256/276 proteins shows that they co-localize in the nucleus and nucleolus (large nuclear aggregates) but are excluded from the internal nuclear membrane. This is emphasized by open arrowheads (h). (j)–(l) A cell co-expressing UL31wt-FLAG and UL34MN{Delta}2/38 proteins displays that distribution of each protein is similar to that in their singly expressed state. (m)–(o) A cell co-expressing UL34wt and UL31MN3{Delta}1/110-GFP proteins shows co-localization in an ER-like area in the cytoplasm. Nu, Nucleus.

 
Next, UL31MN3{Delta}1/110-GFP was co-expressed with UL34 protein and double stained. We found that N-terminally truncated UL31 and UL34wt proteins co-localized strongly at a perinuclear cytoplasmic area (Fig. 2mUpoUp). This suggests that the N-terminal domain of UL31 was not important for its interaction with UL34, but was important for the nuclear targetting of the two proteins. These co-expression experiments and the intracellular localization patterns observed for each of the UL31 and UL34 wt or deletion-mutant proteins are summarized schematically in Fig. 3 (aDowndDown). Quantification of the fraction of cells showing predominantly nuclear localization of UL34 protein for each experiment is shown in Fig. 3 (eDown).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3. (a)–(d) A summary of co-expression experiments of UL31 and UL34 full-length or various truncated versions, which indicates the regions required for internal nuclear membrane targetting and the UL31–UL34 interaction. (a) UL31wt and UL34wt proteins co-localize to the nucleus and the internal nuclear membrane upon co-expression. (b) A UL34 deletion mutant protein lacking 21 amino acids from the hydrophobic domain at the C terminus co-localizes with UL31 protein in the nucleus and nucleoli but not the internal nuclear membrane. (c) UL34 protein lacking its N-terminal residues is not greatly affected by co-expression of UL31wt protein. (d) A UL31 deletion mutant protein lacking 110 N-terminal residues is greatly affected by the presence of UL34 protein and co-localizes at an ER-like area in the cytoplasm. (e) Quantification of predominantly nuclear localization of UL34 protein in cells co-transfected with expression plasmids corresponding to (a)–(d). Cells were co-transfected with the plasmids, fixed after 24 h and detected with anti-UL34 antibody. For each assay, the fraction of cells with predominantly nuclear localization of UL34 protein (similar to the images shown in Fig. 2Up bUp or hUp) was quantified in 200 stained cells.

 
Ye et al. (2000)Down reported recently that UL34 protein interacts with both cytoplasmic dynein intermediate chain and UL31 protein in HSV-1-infected cells and also that UL31 protein depends on UL34 protein for its stability (Ye & Roizman, 2000Down ). The principal site of localization of UL34 protein in infected cells is the nuclear membrane. In transiently expressing cells, however, it localizes predominantly to the ER as a type II membrane protein (Shiba et al., 2000Down ). This observation led to our chief interest in how the protein is translocated, in the presence of other viral proteins, to the nuclear membrane and, in particular, to the internal nuclear membrane. A natural candidate was UL31 protein, a largely insoluble nuclear protein that binds to the nuclear matrix (Chang & Roizman, 1993Down ).

Our present study suggests that the UL31–UL34 interaction is required for translocation of UL34 protein into the nucleus and enrichment at the internal nuclear membrane. UL34 protein, when co-expressed with UL31 protein, exhibited either smooth, fine patterns (Fig. 2bUp) or larger, dotted accumulations (data not shown) in the nucleus. UL31 protein co-localized with UL34 protein in both cases. It was suggested that UL34 protein required UL31 protein for its targetting to the internal nuclear membrane and vice versa. We thus inferred that UL34 protein provides a link for UL31 protein between the internal nuclear membrane and the nuclear matrix. In fact, the deletion of 21 amino acids at the C terminus of UL34 protein eliminated its membrane localization and smooth nuclear patterns and subsequently that of UL31 protein. These findings suggest that the C-terminal region of UL34 protein may be important for nuclear membrane targetting of both proteins. However, this speculation apparently conflicts with a recent report that an HSV-1 mutant lacking sequences encoding the 31 C-terminal residues of UL34 is able to produce a significant number of virus particles in the extracellular space, although this mutant forms plaques and replicates at levels approximately 10-fold lower than those of the wild-type or repaired viruses (Ye & Roizman, 2000Down ). These observations taken together suggest that the loss of the C terminus may be compensated for to some extent by other factors and also that, although not essential, the C terminus is important in the life-cycle of HSV.

Truncating the N terminus of UL31 protein or the C terminus of UL34 protein greatly altered the outcome of their intracellular localization in cells co-expressing the full-length UL34 or UL31 protein, respectively. Most interestingly, when some of the mutant proteins were co-expressed with the other full-length protein, distribution of the former was greatly affected and resembled the staining patterns of the latter. These data suggest that the regions required for interaction between the UL31 and UL34 proteins, or at least the regions that interact more readily, are the non-deleted areas; the N terminus of UL34 protein and the C-terminal two-thirds of UL31 protein. It was reported recently that a mutant virus lacking sequences encoding amino acids 3–119 of UL34 replicated very poorly in rabbit skin cells (Ye & Roizman, 2000Down ). Our study implies that this may have been due to the loss of interaction with UL31 protein.

In mammalian cells infected with a recombinant baculovirus expressing UL34 protein, the majority of the protein co-localizes with the nuclear membranes and is also detected in the perinuclear region or the cytoplasm in a cell line-dependent manner (Ye et al., 2000Down ). In transfected Vero cells, UL34 protein localized at the nuclear membrane but predominantly at the ER. This association with the ER was reduced greatly by co-expression of UL31 protein, which resulted in enrichment at the internal nuclear membrane. We propose that UL34 protein is primarily targetted to the ER, but UL31 protein is able to target it to the nucleus, whereby the hydrophobic C-terminal sequence of UL34 binds to the internal nuclear membrane. How the hydrophobic tail is masked or inactivated until it passes through the nuclear pores into the nucleoplasm is unknown. This effective targetting to the internal nuclear membrane most likely assists the virus in efficient envelopment of capsids.

The role of this interaction in infection is under investigation, but another interesting issue is how the US3 protein kinase is related. In simultaneous triple expression of UL31, UL34 and US3 proteins, the fine nuclear pattern of UL34 protein was disrupted (data not shown), so the environment surrounding UL34 protein and the timing of expression seem to be crucial. A US3-deletion mutant of pseudorabies virus has been observed to accumulate enveloped virus particles in the perinuclear space. In the absence of UL34, budding at the inner nuclear membrane does not occur, whereas, in the absence of US3 (and possibly a lack of phosphorylation of UL34), de-envelopment at the outer nuclear membrane seems to be blocked (Klupp et al., 2000Down ). The majority of phosphorylated UL34 protein (32·5 kDa) is present in infected cells as a protease-sensitive form, suggesting that the unphosphorylated 31 kDa protein participates in envelopment before the 32·5 kDa protein (Shiba et al., 2000Down ). The role of US3 protein in the phosphorylation of UL34 protein is also a future aspect of our research.


   Acknowledgments
 
We would like to thank E. Iwata and T. Tsuruguchi for technical assistance. This work was supported by a grant from the Japan Society for the Promotion of Science (JSPS-RFTF97L00703) and also by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture of Japan.


   References
TOP
Abstract
Main text
References
 
Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S. & Barrell, B. G. (1984). DNA sequence and expression of the B95-8 Epstein–Barr virus genome. Nature 310, 207-211.[Medline]

Chang, Y. E. & Roizman, B. (1993). The product of the UL31 gene of herpes simplex virus 1 is a nuclear phosphoprotein which partitions with the nuclear matrix. Journal of Virology 67, 6348-6356.[Abstract/Free Full Text]

Chee, M. S., Bankier, A. T., Beck, S., Bohni, R., Brown, C. M., Cerny, R., Horsnell, T., Hutchison, C. A., Kouzarides, T., Martignetti, J. A., Preddie, E., Satchwell, S. C., Tomlinson, P., Weston, K. M. & Barrell, B. G. (1990). Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Current Topics in Microbiology and Immunology 154, 125-169.[Medline]

Daikoku, T., Yamashita, Y., Tsurumi, T., Maeno, K. & Nishiyama, Y. (1993). Purification and biochemical characterization of the protein kinase encoded by the US3 gene of herpes simplex virus type 2. Virology 197, 685-694.[Medline]

Daikoku, T., Kurachi, R., Tsurumi, T. & Nishiyama, Y. (1994). Identification of a target protein of US3 protein kinase of herpes simplex virus type 2. Journal of General Virology 75, 2065-2068.[Abstract/Free Full Text]

Davison, A. J. & Scott, J. E. (1986). The complete DNA sequence of varicella-zoster virus. Journal of General Virology 67, 1759-1816.[Abstract/Free Full Text]

Dolan, A., Jamieson, F. E., Cunningham, C., Barnett, B. C. & McGeoch, D. J. (1998). The genome sequence of herpes simplex virus type 2. Journal of Virology 72, 2010-2021.[Abstract/Free Full Text]

Gompels, U. A., Nicholas, J., Lawrence, G., Jones, M., Thomson, B. J., Martin, M. E. D., Efstathiou, S., Craxton, M. & Macaulay, H. A. (1995). The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology 209, 29-51.[Medline]

Klupp, B. G., Granzow, H. & Mettenleiter, T. C. (2000). Primary envelopment of pseudorabies virus at the nuclear membrane requires the UL34 gene product. Journal of Virology 74, 10063-10073.[Abstract/Free Full Text]

McGeoch, D. J. (1992). Molecular evolution of large DNA viruses of eukaryotes. Seminars in Virology 3, 399-408.

Nicholas, J. (1996). Determination and analysis of the complete nucleotide sequence of human herpesvirus 7. Journal of Virology 70, 5975-5989.[Abstract]

Purves, F. C., Spector, D. & Roizman, B. (1991). The herpes simplex virus 1 protein kinase encoded by the US3 gene mediates posttranslational modification of the phosphoprotein encoded by the UL34 gene. Journal of Virology 65, 5757-5764.[Abstract/Free Full Text]

Purves, F. C., Spector, D. & Roizman, B. (1992). UL34, the target of the herpes simplex virus US3 protein kinase, is a membrane protein which in its unphosphorylated state associates with novel phosphoproteins. Journal of Virology 66, 4295-4303.[Abstract/Free Full Text]

Roizman, B. & Sears, A. E. (1996). Herpes simplex viruses and their replication. In Fields Virology , pp. 2231-2295. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Roller, R. J. & Roizman, B. (1991). Herpes simplex virus 1 RNA-binding protein US11 negatively regulates the accumulation of a truncated viral mRNA. Journal of Virology 65, 5873-5879.[Abstract/Free Full Text]

Roller, R. J., Zhou, Y., Schnetzer, R., Ferguson, J. & DeSalvo, D. (2000). Herpes simplex virus type 1 UL34 gene product is required for viral envelopment. Journal of Virology 74, 117-129.[Abstract/Free Full Text]

Shiba, C., Daikoku, T., Goshima, F., Takakuwa, H., Yamauchi, Y., Koiwai, O. & Nishiyama, Y. (2000). The UL34 gene product of herpes simplex virus type 2 is a tail-anchored type II membrane protein that is significant for virus envelopment. Journal of General Virology 81, 2397-2405.[Abstract/Free Full Text]

Yamada, H., Jiang, Y.-M., Oshima, S., Daikoku, T., Yamashita, Y., Tsurumi, T. & Nishiyama, Y. (1998). Characterization of the UL55 gene product of herpes simplex virus type 2. Journal of General Virology 79, 1989-1995.[Abstract]

Ye, G. J. & Roizman, B. (2000). The essential protein encoded by the UL31 gene of herpes simplex virus 1 depends for its stability on the presence of UL34 protein. Proceedings of the National Academy of Sciences, USA 97, 11002-11007.[Abstract/Free Full Text]

Ye, G. J., Vaughan, K. T., Vallee, R. B. & Roizman, B. (2000). The herpes simplex virus 1 UL34 protein interacts with a cytoplasmic dynein intermediate chain and targets nuclear membrane. Journal of Virology 74, 1355-1363.[Abstract/Free Full Text]

Zhu, H. Y., Yamada, H., Jiang, Y. M., Yamada, M. & Nishiyama, Y. (1999). Intracellular localization of the UL31 protein of herpes simplex virus type 2. Archives of Virology 144, 1923-1935.[Medline]

Received 13 November 2000; accepted 20 February 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
F. Mou, E. Wills, and J. D. Baines
Phosphorylation of the UL31 Protein of Herpes Simplex Virus 1 by the US3-Encoded Kinase Regulates Localization of the Nuclear Envelopment Complex and Egress of Nucleocapsids
J. Virol., May 15, 2009; 83(10): 5181 - 5191.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. D. Sam, B. T. Evans, D. M. Coen, and J. M. Hogle
Biochemical, Biophysical, and Mutational Analyses of Subunit Interactions of the Human Cytomegalovirus Nuclear Egress Complex
J. Virol., April 1, 2009; 83(7): 2996 - 3006.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. Mou, E. G. Wills, R. Park, and J. D. Baines
Effects of Lamin A/C, Lamin B1, and Viral US3 Kinase Activity on Viral Infectivity, Virion Egress, and the Targeting of Herpes Simplex Virus UL34-Encoded Protein to the Inner Nuclear Membrane
J. Virol., August 15, 2008; 82(16): 8094 - 8104.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Kuhn, T. Leege, B. G. Klupp, H. Granzow, W. Fuchs, and T. C. Mettenleiter
Partial Functional Complementation of a Pseudorabies Virus UL25 Deletion Mutant by Herpes Simplex Virus Type 1 pUL25 Indicates Overlapping Functions of Alphaherpesvirus pUL25 Proteins
J. Virol., June 15, 2008; 82(12): 5725 - 5734.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Yamauchi, K. Kiriyama, H. Kimura, and Y. Nishiyama
Herpes simplex virus induces extensive modification and dynamic relocalisation of the nuclear mitotic apparatus (NuMA) protein in interphase cells
J. Cell Sci., June 15, 2008; 121(12): 2087 - 2096.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Santarelli, A. Farina, M. Granato, R. Gonnella, S. Raffa, L. Leone, R. Bei, A. Modesti, L. Frati, M. R. Torrisi, et al.
Identification and Characterization of the Product Encoded by ORF69 of Kaposi's Sarcoma-Associated Herpesvirus
J. Virol., May 1, 2008; 82(9): 4562 - 4572.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. Camozzi, S. Pignatelli, C. Valvo, G. Lattanzi, C. Capanni, P. Dal Monte, and M. P. Landini
Remodelling of the nuclear lamina during human cytomegalovirus infection: role of the viral proteins pUL50 and pUL53
J. Gen. Virol., March 1, 2008; 89(3): 731 - 740.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. Leach, S. L. Bjerke, D. K. Christensen, J. M. Bouchard, F. Mou, R. Park, J. Baines, T. Haraguchi, and R. J. Roller
Emerin Is Hyperphosphorylated and Redistributed in Herpes Simplex Virus Type 1-Infected Cells in a Manner Dependent on both UL34 and US3
J. Virol., October 1, 2007; 81(19): 10792 - 10803.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Schnee, Z. Ruzsics, A. Bubeck, and U. H. Koszinowski
Common and Specific Properties of Herpesvirus UL34/UL31 Protein Family Members Revealed by Protein Complementation Assay
J. Virol., December 1, 2006; 80(23): 11658 - 11666.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Kato, M. Yamamoto, T. Ohno, M. Tanaka, T. Sata, Y. Nishiyama, and Y. Kawaguchi
Herpes Simplex Virus 1-Encoded Protein Kinase UL13 Phosphorylates Viral Us3 Protein Kinase and Regulates Nuclear Localization of Viral Envelopment Factors UL34 and UL31
J. Virol., February 1, 2006; 80(3): 1476 - 1486.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Simpson-Holley, R. C. Colgrove, G. Nalepa, J. W. Harper, and D. M. Knipe
Identification and Functional Evaluation of Cellular and Viral Factors Involved in the Alteration of Nuclear Architecture during Herpes Simplex Virus 1 Infection
J. Virol., October 15, 2005; 79(20): 12840 - 12851.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Farina, R. Feederle, S. Raffa, R. Gonnella, R. Santarelli, L. Frati, A. Angeloni, M. R. Torrisi, A. Faggioni, and H.-J. Delecluse
BFRF1 of Epstein-Barr Virus Is Essential for Efficient Primary Viral Envelopment and Egress
J. Virol., March 15, 2005; 79(6): 3703 - 3712.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Gonnella, A. Farina, R. Santarelli, S. Raffa, R. Feederle, R. Bei, M. Granato, A. Modesti, L. Frati, H.-J. Delecluse, et al.
Characterization and Intracellular Localization of the Epstein-Barr Virus Protein BFLF2: Interactions with BFRF1 and with the Nuclear Lamina
J. Virol., March 15, 2005; 79(6): 3713 - 3727.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Bubeck, M. Wagner, Z. Ruzsics, M. Lotzerich, M. Iglesias, I. R. Singh, and U. H. Koszinowski
Comprehensive Mutational Analysis of a Herpesvirus Gene in the Viral Genome Context Reveals a Region Essential for Virus Replication
J. Virol., August 1, 2004; 78(15): 8026 - 8035.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. E. Reynolds, L. Liang, and J. D. Baines
Conformational Changes in the Nuclear Lamina Induced by Herpes Simplex Virus Type 1 Require Genes UL31 and UL34
J. Virol., June 1, 2004; 78(11): 5564 - 5575.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Simpson-Holley, J. Baines, R. Roller, and D. M. Knipe
Herpes Simplex Virus 1 UL31 and UL34 Gene Products Promote the Late Maturation of Viral Replication Compartments to the Nuclear Periphery
J. Virol., June 1, 2004; 78(11): 5591 - 5600.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. L. Bjerke, J. M. Cowan, J. K. Kerr, A. E. Reynolds, J. D. Baines, and R. J. Roller
Effects of Charged Cluster Mutations on the Function of Herpes Simplex Virus Type 1 UL34 Protein
J. Virol., July 1, 2003; 77(13): 7601 - 7610.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. E. Reynolds, E. G. Wills, R. J. Roller, B. J. Ryckman, and J. D. Baines
Ultrastructural Localization of the Herpes Simplex Virus Type 1 UL31, UL34, and US3 Proteins Suggests Specific Roles in Primary Envelopment and Egress of Nucleocapsids
J. Virol., July 29, 2002; 76(17): 8939 - 8952.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. Dal Monte, S. Pignatelli, N. Zini, N. M. Maraldi, E. Perret, M. C. Prevost, and M. P. Landini
Analysis of intracellular and intraviral localization of the human cytomegalovirus UL53 protein
J. Gen. Virol., May 1, 2002; 83(5): 1005 - 1012.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. Fuchs, B. G. Klupp, H. Granzow, N. Osterrieder, and T. C. Mettenleiter
The Interacting UL31 and UL34 Gene Products of Pseudorabies Virus Are Involved in Egress from the Host-Cell Nucleus and Represent Components of Primary Enveloped but Not Mature Virions
J. Virol., January 1, 2002; 76(1): 364 - 378.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamauchi, Y.
Right arrow Articles by Nishiyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamauchi, Y.
Right arrow Articles by Nishiyama, Y.
Agricola
Right arrow Articles by Yamauchi, Y.
Right arrow Articles by Nishiyama, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS