J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Agricola
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Journal of General Virology (2000), 81, 195-199.
© 2000 Society for General Microbiology


Animal: RNA Viruses

Expression and processing of the canine calicivirus capsid precursor

Yuichi Matsuura1, Yukinobu Tohya1, Mihoko Onuma1, Frank Roerink2, Masami Mochizuki3 and Takaaki Sugimura1

Laboratory of Veterinary Microbiology, Department of Veterinary Medicine, Faculty of Agriculture, Kagoshima University, 1-21-24 Korimoto, Kagoshima, 890-0065 Japan1
Tsukuba Central Laboratories, Kyoritsu Shoji Corporation, 2-9-22 Takamihara, Kukizaki-Machi, Inashiki-Gun, Ibaraki-Ken, 300-1252 Japan2
Laboratory of Clinical Microbiology, Kyoritsu Shoji Corporation, 1-12-4 Kudan-Kita, Chiyoda-ku, Tokyo, 102-0073 Japan3

Author for correspondence: Yukinobu Tohya. Fax +81 99 285 8725. e-mail ytohya{at}vet.agri.kagoshima-u.ac.jp


   Abstract
TOP
Abstract
Main text
References
 
The ORF2 product of canine calicivirus (CaCV) was identified and its processing in mammalian cells was analysed. Immunoblot analysis revealed the presence of the 75 kDa capsid precursor in addition to a 57 kDa capsid protein and a 22 kDa N-terminal polypeptide in CaCV-infected cells treated at an elevated temperature. When the CaCV ORF2 was expressed in a transient mammalian expression system, only the 75 kDa precursor was detected in immunoblot analysis, suggesting that no post-translational processing occurred in this system. However, the precursor was processed to a 57 kDa protein and a 22 kDa polypeptide by the proteinase of feline calicivirus (FCV) when this was co-expressed with ORF2. Processing was blocked by site-directed mutagenesis of the putative cleavage site in the capsid precursor. The results indicate that the proteinase of FCV can cleave the capsid precursor of CaCV to produce the mature capsid protein and that CaCV may have a similar proteinase.


   Main text
TOP
Abstract
Main text
References
 
Canine calicivirus (CaCV) No. 48 strain was isolated from a domestic dog with fatal diarrhoea (Mochizuki et al., 1993Down ). Although the virion, antigenic and biological properties of CaCV No. 48 strain are similar to those of the first CaCV strain described by Schaffer et al. (1985)Down , very little is known about genome organization and replication. Recently, the presence of three open reading frames (ORFs) in the genome of CaCV No. 48 strain was demonstrated by sequence analysis of a region from the RNA polymerase to the 3' poly(A) tail of its genome (Roerink et al., 1999Down ). It was suggested that ORF2 encoded the capsid precursor as its deduced amino acid sequence had relatively high similarity to that of feline calicivirus (FCV) and San Miguel sealion virus (SMSV). In this study, the product of ORF2 was identified and its processing was analysed by co-expression of CaCV ORF2 and the putative proteinase region in FCV ORF1 in COS-7 cells.

CaCV No. 48 strain was propagated in Miyazaki University canine mammary gland mixed tumour (MCM-B2) cells (Priosoeryanto et al., 1995Down ). In order to inhibit proteolytic processing, CaCV-infected cells were treated at an elevated temperature of 45 °C as previously described (Carter, 1989Down ; Shin et al., 1993Down ).

A serum monospecific to the capsid protein was obtained from BALB/c mice that had been immunized with approximately 10 µg/mouse CaCV capsid protein. The capsid protein used for the immunization was prepared as follows. CsCl-purified virus was separated by 10% SDS–PAGE and stained with Coomassie brilliant blue R250 as described previously (San Gabriel et al., 1997Down ). The band of the capsid protein was sliced and eluted in an electro-eluter (Model 422; Bio-Rad). The eluted protein was precipitated with acetone and resuspended in PBS for future use.

The CaCV ORF2 expression plasmid was constructed as follows. CaCV RNA was extracted from the purified CaCV suspension as previously described (Roerink et al., 1999Down ). Reverse transcription was carried out using oligo(dT) primer. A cDNA fragment was produced by PCR using synthetic oligonucleotides CaCV1 (5' GAACTCGAGATGGCTCGC TATCTTGAACT 3') and CaCV2 (5' GCTCTAGATCAT AGTGTTGTAGCGCTAC 3') as primers. Primer CaCV1 corresponded to nt 1–20 of the CaCV ORF2 with a XhoI restriction enzyme site upstream from the first ATG initiation codon (underlined), and primer CaCV2 was complementary to nt 2057–2076 of the CaCV ORF2 and contained an XbaI restriction enzyme site. The PCR-amplified fragment was digested by XhoI and XbaI, and cloned between the XhoI and XbaI sites of the pME18S expression vector (Shin et al., 1993Down ). The constructed plasmid was designated pDCV-II, and contained the first ATG of ORF2 directly under the control of the SR{alpha} promoter (Takebe et al., 1988Down ). pMCV-3C, which expresses the putative 3C region of FCV strain F4 (Oshikamo et al., 1994Down ), was constructed as follows. A cDNA fragment including the putative 3C region was generated by PCR with synthetic oligonucleotides XHO-ATG5'3C (5' AATCTCGAGATGT CTGGGCCTGGCACTAA 3') and PST-TCA-3'3C (5' GGCTGCAGTCATTCCAAGAAGATGTTCAT 3') as primers and a plasmid containing the ORF1 of FCV F4 as template. Primer XHO-ATG5'3C corresponded to nt 3214–3230 of the FCV ORF1 with a XhoI restriction enzyme site and an initiation codon, and primer PST-TCA-3'3C was complementary to nt 4018–4035 of the FCV ORF1 and contained a PstI restriction enzyme site and a termination codon. The PCR-amplified fragment was digested by XhoI and PstI, and cloned between the XhoI and PstI sites of pME18S. The FCV ORF2 expression vector pMCV-II was constructed as described previously (Shin et al., 1993Down ). Three micrograms of pDCV-II or pMCV-II and 1 µg pMCV-3C or pME18S were co-transfected into COS-7 cells according to previously described methods with minor modifications (Seed & Aruffo, 1987Down ; Shin et al., 1993Down ).

Detection and identification of the CaCV capsid precursor were performed by immunoblot analysis using the serum monospecific to the capsid protein (Fig. 1aDown, lanes 1–3, and 5). The serum showed specific reactivity with 57 kDa capsid protein in CaCV-infected cells (Fig. 1aDown, lane 2). In CaCV- infected cells, which were treated at an elevated temperature of 45 °C, 75 kDa and 57 kDa proteins were specifically detected (Fig. 1aDown, lane 3). This phenomenon was also seen in similar experiments using SMSV- and FCV-infected cells (Fretz & Schaffer, 1978Down ; Carter, 1989Down ; Shin et al., 1993Down ). The 75 kDa protein was identified as the precursor of the 57 kDa CaCV capsid protein in this study. When the ORF2 of CaCV was expressed transiently in COS-7 cells by transfection with pDCV-II, the 75 kDa protein was detected in the immunoblot analysis (Fig. 1aDown, lane 5). The additional bands above the 75 kDa protein may be polypeptides translated by incorrect initiation from an ATG codon in-frame and upstream from the first ATG of CaCV ORF2 or by read-through of the termination. In addition, low density minor bands were considered to be degraded products of the capsid precursor as described previously (Shin et al., 1993Down ). The molecular mass of the 75 kDa protein detected in the pDCV-II-transfected cells was similar to that expected if the CaCV ORF2 was translated from the first ATG in ORF2 to its termination codon (i.e. 76180 Da). The mobility of the 75 kDa protein in the transfected cells was identical to that of the capsid precursor (Fig. 1aDown, lanes 3 and 5). The expressed protein therefore seems to have the same basic characteristics as the CaCV capsid precursor both in antigenicity and in electromobility. This result also suggests that no post-translational processing by autocatalytic or host cell-mediated cleavage has occurred in this system.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. Immunoblot analysis of the capsid precursor and proteolytic processing of the capsid protein of CaCV. Infected cells and transfected cells were solubilized and electrophoresed in 7·5 % (a) and 15% (b) polyacrylamide gels. The resolved proteins were electro-transferred onto membranes. Blots were detected with serum monospecific to the CaCV capsid protein (a, lanes 1–6), a MAb to the FCV capsid protein (a, lanes 7–9) and anti-GST/NTP serum (b). Lanes: 1, mock-infected MCM-B2 cells; 2, CaCV No. 48-infected MCM-B2 cells; 3, MCM-B2 cells infected with CaCV No. 48 and treated at 45 °C; 4–9, COS-7 cells transfected with plasmids, pDCV-II and pMCV-3C (lane 4), pDCV-II and pME18S (lane 5), pMCV-3C (lanes 6 and 9), pMCV-II and pMCV-3C (lane 7), pMCV-II and pME18S (lane 8).

 
It has been reported that FCV-encoded proteinase mediates the cleavage of the capsid precursor (Sosnovtsev et al., 1998Down ). We examined whether a polypeptide of the putative 3C proteinase region is active in our expression system using pMCV-3C (Fig. 1aUp, lanes 7–9). In COS-7 cells which were co-transfected with pMCV-3C and pMCV-II, the 62 kDa capsid protein of FCV, in addition to the 76 kDa capsid precursor, was detected by immunoblot analysis using a MAb against the capsid protein (Fig. 1aUp, lane 7). As the transiently expressed proteinase in this study was confirmed to be active, proteolytic processing of the CaCV capsid protein was analysed by immunoblotting with COS-7 cells co-transfected with pDCV- II and pMCV-3C (Fig. 1aUp, lane 4). The 75 kDa and 57 kDa proteins were detected in the co-transfected COS-7 cells. The molecular mass of the detected proteins in the co-transfected COS-7 cells was equivalent to that of the corresponding capsid protein and precursor which were detected in the CaCV- infected cells (Fig. 1aUp, lanes 3 and 4). This showed that the 75 kDa CaCV precursor was processed to a 57  kDa protein by the co-expressed proteinase of FCV in the COS-7 cells.

In FCV, the capsid precursor is cleaved by a virus-encoded proteinase between amino acid positions 124 and 125 (Glu124 and Ala125) (Sosnovtsev et al., 1998Down ), and the 14 kDa N- terminal polypeptide was identified in infected cells (Tohya et al., 1999Down ). In CaCV, a corresponding cleavage site (Glu157/Ser158) was suggested by homology analysis with FCV and SMSV (Roerink et al., 1999Down ). In order to determine whether the FCV proteinase cleaved at the corresponding site in the CaCV capsid precursor, we prepared a serum against an N-terminal polypeptide (NTP) corresponding to amino acids Met1 to Glu157 of the capsid precursor using a glutathione S-transferase (GST)/NTP fusion protein. The GST/NTP fusion protein expression plasmid was constructed as follows. The 5'-end 471 nt region of ORF2 encoding the NTP was PCR-amplified using plasmid pDCV-II as the template and synthetic oligonucleotides CaCV ORF2-A (CTCAGGATCCAGATG GCTCGCTATCTTGAA) and CaCV ORF2-AR (ATACT CGAGTTCCGCGCGGAATTGGAATTC) as primers. Primer CaCV ORF2-A corresponded to nt 1–18 of the CaCV ORF2 with a BamHI restriction enzyme site and additional nucleotides (AG) upstream of the ATG initiation codon to adjust the frame, and CaCV ORF2-AR was complementary to nt 451–471 of the ORF2 and contained a XhoI restriction enzyme site. The PCR-amplified fragment was cloned between the BamHI and XhoI sites of the vector pGEX-5X-1 (Pharmacia Biotech). Expression and purification of the fusion protein and immunization of mice were performed as described previously (Tohya et al., 1999Down ).

The results of immunoblot analysis using the anti- GST/NTP serum are shown in Fig. 1(b)Up. The serum showed specific reactivity with a 22 kDa polypeptide in the CaCV- infected cells (Fig. 1bUp, lane 2). The anti-GST serum prepared as a control showed no specific reactivity with the proteins in the cells (data not shown). In addition to the 22 kDa polypeptide, the 75 kDa capsid precursor was detected in CaCV-infected cells which were treated at the elevated temperature (Fig. 1bUp, lane 3), indicating that the cleaved N-terminal part of the capsid precursor has a molecular mass of 22 kDa, although the molecular mass of the 22 kDa polypeptide was a little larger than the mass of 18256 Da deduced from sequence analysis. The 22 kDa polypeptide, in addition to the 75 kDa capsid precursor, was also detected only in the pDCV-II and pMCV-3C co-transfected COS-7 cells, and not in the pDCV-II and pME18S co-transfected cells (Fig. 1bUp, lanes 4 and 5). The result suggested that the proteinase of FCV cleaves at the authentic site in the capsid precursor of CaCV and that CaCV may have a similar proteinase possibly encoded in its ORF1.

A feature of the FCV proteinase is its high substrate specificity that is determined by the structure of the cleavage site sequence (Sosnovtsev et al., 1998Down ). In order to confirm the suggested cleavage site (Glu157/Ser158), we investigated whether processing of the CaCV capsid precursor could be blocked by the co-expression system. The XhoI/EcoRV fragment (924 bp) containing the 5'-end of ORF2 was excised from pDCV-II and ligated into pBluescript II KS(+) (Stratagene). The Glu 157 mutation (GAA to AAA for Lys) and the Ser158 mutation (TCC to CCC for Pro) were introduced, respectively, into the fragment using mutagenic oligonu- cleotides designed to create substitutional mutations and the TaKaRa LA PCR In Vitro Mutagenesis kit (TAKARA) according to the manufacturer’s instructions. After both mutations in the fragments were confirmed by sequence analysis, the mutated fragments were used to replace the parent fragment in pDCV-II. The mutated expression plasmids were designated pDCV-II mut EK and pDCV-II mut SP for the Glu157 and Ser158 mutations, respectively. In the COS-7 cells co-transfected with the mutated plasmids and the pMCV-3C, the mature 57 kDa capsid protein was not detected by immunoblot analysis using the serum monospecific to the capsid protein (Fig. 2Down, lanes 2 and 3). The result shows that processing by the FCV proteinase was blocked by changing the amino acids at the site and strongly suggests that the Glu157/Ser 158 site is the cleavage site in the CaCV capsid precursor by the virus-encoding proteinase.



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 2. Analysis of the cleavage site in the CaCV capsid precursor by site- directed mutagenesis. The mutated capsid precursor was co-expressed with the proteinase of FCV in COS-7 cells. The expressed polypeptides were detected by immunoblot analysis using a serum monospecific to the CaCV capsid protein. COS-7 cells were transfected with the following plasmids: pDCV-II and pMCV-3C (lane 1); pDCV-II mut EK and pMCV-3C (lane 2); pDCV-II mut SP and pMCV-3C (lane 3); and pMCV-3C (lane 4).

 
In the members of Caliciviridae, only FCV and SMSV have been known to produce capsid precursor proteins (Carter, 1989Down ; Fretz & Schaffer, 1978Down ). Their ORF2s are larger than the corresponding regions for the capsid genes of other calici- viruses (Neill, 1992Down ). The Caliciviridae study group of the International Committee on Taxonomy of Viruses (Pringle, 1998Down ) has proposed a new genus, Vesivirus, with type species swine vesicular exanthema virus. Sequence analysis suggests that FCV and SMSV would be classified in this genus with newly analysed CaCV, which also has a larger ORF2 (Roerink et al., 1999Down ). In this study, the 75 kDa capsid precursor was identified as the translational product from ORF2 of CaCV and its cleavage by a viral proteinase was shown. Following the cleavage of the capsid precursor, the C-terminal part forms the mature 57 kDa capsid protein and the N-terminal part forms the 22 kDa polypeptide (Fig. 3Down). As the system for expression and processing of the capsid precursor of CaCV revealed in this study resembled that of the FCV system (Sosnovtsev et al., 1998Down ; Tohya et al., 1999Down ) and the FCV proteinase was compatible in the CaCV system, similar systems for ORF2 expression may be adopted by caliciviruses in the genus Vesivirus.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. Expression and processing of the capsid precursor of CaCV. The top line indicates the region from the RNA polymerase to the 3' poly(A) tail of CaCV RNA genome, the sequence of which has been reported (Roerink et al., 1999Down ). The ORFs are shown as open boxes and polypeptides translated from each ORF are shown as filled-in boxes. In ORF1, only the RNA polymerase region is shown, because the upstream part of the ORF1 sequence is unknown. The capsid precursor translated from ORF2 would be cleaved by proteinase that might be translated from a region upstream of the RNA polymerase in ORF1 and processed into the mature capsid protein and a 22 kDa N-terminal polypeptide.

 

   Acknowledgments
 
The authors would like to thank Dr K. Yoshida, Laboratory of Clinical Virology, Kyushu Research Station, National Institute of Animal Health, for help in preparation of the figures. This work was supported by grants from the Ministry of Education, Science, Sports and Culture of Japan.


   References
TOP
Abstract
Main text
References
 
Carter, M. J. (1989). Feline calicivirus protein synthesis investigated by Western blotting. Archives of Virology 108, 69-79.[Medline]

Fretz, M. & Schaffer, F. L. (1978). Calicivirus proteins in infected cells: evidence for a capsid polypeptide precursor. Virology 89, 318-321.[Medline]

Mochizuki, M., Kawanishi, A., Sakamoto, H., Tashiro, S., Fujimoto, R. & Ohwaki, M. (1993). A calicivirus isolated from a dog with fatal diarrhoea. Veterinary Record 132, 221-222.[Medline]

Neill, J. D. (1992). Nucleotide sequence of the capsid protein gene of two serotypes of San Miguel sea lion virus: identification of conserved and non-conserved amino acid sequences among calicivirus capsid proteins. Virus Research 24, 211-222.[Medline]

Oshikamo, R., Tohya, Y., Kawaguchi, Y., Tomonaga, K., Maeda, K., Takeda, N., Utagawa, E., Kai, C. & Mikami, T. (1994). The molecular cloning and sequence of an open reading frame encoding for non- structural proteins of feline calicivirus F4 strain isolated in Japan. Journal of Veterinary Medical Science 56, 1093-1099.[Medline]

Pringle, C. R. (1998). Virus Taxonomy – San Diego 1998. Archives of Virology 143, 1449-1459.[Medline]

Priosoeryanto, B. P., Tateyama, S., Yamaguchi, R. & Uchida, K. (1995). Establishment of a cell line (MCM-B2) from a benign mixed tumour of canine mammary gland. Research in Veterinary Science 58, 272-276.[Medline]

Roerink, F., Hashimoto, M., Tohya, Y. & Mochizuki, M. (1999). Organization of the canine calicivirus genome from the RNA polymerase gene to the poly(A) tail. Journal of General Virology 80, 929-935.[Abstract]

San Gabriel, M. C. S., Tohya, Y., Sugimura, T., Shimizu, T., Ishiguro, S. & Mochizuki, M. (1997). Identification of canine calicivirus capsid protein and its immunoreactivity in western blotting. Journal of Veterinary Medical Science 59, 97-101.[Medline]

Schaffer, F. L., Soergel, M. E., Black, J. W., Skilling, D. E., Smith, A. W. & Cubitt, W. D. (1985). Characterization of a new calicivirus isolated from feces of a dog. Archives of Virology 84, 181-195.

Seed, B. & Aruffo, A. (1987). Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure. Proceedings of the National Academy of Sciences, USA 84, 3365-3369.[Abstract/Free Full Text]

Shin, Y.-S., Tohya, Y., Oshikamo, R., Kawaguchi, Y., Tomonaga, K., Miyazawa, T., Kai, C. & Mikami, T. (1993). Antigenic analysis of feline calicivirus capsid precursor protein and its deleted polypeptides produced in a mammalian cDNA expression system. Virus Research 30, 17-26.[Medline]

Sosnovtsev, S. V., Sosnovtseva, S. A. & Green, K. Y. (1998). Cleavage of the feline calicivirus capsid precursor is mediated by a virus-encoded proteinase. Journal of Virology 72, 3051-3059.[Abstract/Free Full Text]

Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M. & Arai, N. (1988). SR{alpha} promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Molecular and Cellular Biology 8, 466-472.[Abstract/Free Full Text]

Tohya, Y., Shinchi, H., Matsuura, Y., Maeda, K., Ishiguro, S., Mochizuki, M. & Sugimura, T. (1999). Analysis of the N-terminal polypeptide of the capsid precursor protein and the ORF3 product of feline calicivirus. Journal of Veterinary Medical Science 60, 1043-1047.

Received 26 April 1999; accepted 16 September 1999.


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Chen, J. D. Neill, M. K. Estes, and B. V. V. Prasad
X-ray structure of a native calicivirus: Structural insights into antigenic diversity and host specificity
PNAS, May 23, 2006; 103(21): 8048 - 8053.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Oehmig, M. Buttner, F. Weiland, W. Werz, K. Bergemann, and E. Pfaff
Identification of a calicivirus isolate of unknown origin
J. Gen. Virol., October 1, 2003; 84(10): 2837 - 2845.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
M. Mochizuki, M. Hashimoto, F. Roerink, Y. Tohya, Y. Matsuura, and N. Sasaki
Molecular and Seroepidemiological Evidence of Canine Calicivirus Infections in Japan
J. Clin. Microbiol., July 1, 2002; 40(7): 2629 - 2631.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. V. Sosnovtsev, M. Garfield, and K. Y. Green
Processing Map and Essential Cleavage Sites of the Nonstructural Polyprotein Encoded by ORF1 of the Feline Calicivirus Genome
J. Virol., June 14, 2002; 76(14): 7060 - 7072.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
Y. Matsuura, Y. Tohya, M. Mochizuki, K. Takase, and T. Sugimura
Identification of conformational neutralizing epitopes on the capsid protein of canine calicivirus
J. Gen. Virol., July 1, 2001; 82(7): 1695 - 1702.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Agricola
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS