J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Netolitzky, D. J.
Right arrow Articles by Nagata, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Netolitzky, D. J.
Right arrow Articles by Nagata, L. P.
Agricola
Right arrow Articles by Netolitzky, D. J.
Right arrow Articles by Nagata, L. P.
Journal of General Virology (2000), 81, 151-159.
© 2000 Society for General Microbiology


Animal: RNA Viruses

Complete genomic RNA sequence of western equine encephalitis virus and expression of the structural genes

Donald J. Netolitzkyb,1, Fay L. Schmaltz1, Michael D. Parker2, George A. Rayner1, Glen R. Fisher1, Dennis W. Trent3, Douglas E. Bader1 and Les P. Nagata1

Defence Research Establishment Suffield, Medical Countermeasures Section, PO Box 4000 Station Main, Medicine Hat, Alberta, Canada T1A 8K61
Virology Division, US Army Medical Research Institute for Infectious Diseases, Fort Detrick, Frederick, MD, USA2
Regulatory Division, Pasteur Merieux Connaught, Swiftwater, PA, USA3

Author for correspondence: Les Nagata. Fax +1 403 544 3388. e-mail les.nagata{at}dres.dnd.ca


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The complete nucleotide sequence of the 71V-1658 strain of western equine encephalitis virus (WEE) was determined (minus 25 nucleotides from the 5' end). A 5' RACE reaction was used to sequence the 5' terminus from WEE strain CBA87. The deduced WEE genome was 11508 nucleotides in length, excluding the 5' cap nucleotide and 3' poly(A) tail. The nucleotide composition was 28% A, 25% C, 25% G and 22% U. Comparison with partial WEE sequences of strain 5614 (nsP2–nsP3 of the nonstructural region) and strain BFS1703 (26S structural region) revealed comparatively little variation; a total of 149 nucleotide differences in 8624 bases (1·7% divergence), of which only 28% (42 nucleotides) altered the encoded amino acids. Comparison of deduced nsP1 and nsP4 amino acid sequences from WEE with the corresponding proteins from eastern equine encephalitis virus (EEE) yielded identities of 84·9 and 83·8%, respectively. Previously uncharacterized stem–loop structures were identified in the nontranslated terminal regions. A cDNA clone of the 26S region encoding the structural polyprotein of WEE strain 71V-1658 was placed under the control of a cytomegalovirus promoter and transfected into tissue culture cells. The viral envelope proteins were functionally expressed in tissue culture, as determined by histochemical staining with monoclonal antibodies that recognize WEE antigens, thus, forming the initial step in the investigation of subunit vaccines to WEE.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The alphaviruses are a group of about 27 enveloped viruses with positive-sense, nonsegmented, single-stranded RNA genomes (Calisher et al., 1980Down ; Strauss & Strauss, 1988Down ). The alphavirus studied in this report, western equine encephalitis virus (WEE), is a member of the WEE antigenic complex and is serologically related to the Sindbis (SIN), Highlands J (HJ), Fort Morgan, Buggy Creek and Aura viruses (Calisher & Karabatsos, 1988Down ; Calisher et al., 1988Down ). WEE is endemic in western North America and strains/varieties have also been isolated from Argentina (AG80-646), Brazil (BeAr 102091) and the former Soviet Union (Y62-33) (Johnston & Peters, 1996Down ; Weaver et al., 1997Down ). In nature, WEE is transmitted from its amplifying hosts or reservoir in wild birds to man and horses by mosquitoes (Culex tarsalis being the principal vector). While the endemic cycle has resulted in only a limited number of human infections in recent years, in the past, major epidemics of WEE have been recorded. The most extensive epidemic, including 3336 recognized human cases and 300000 cases of encephalitis in horses and mules, occurred in the western United States and Canada in 1941 (Reisen & Monath, 1988Down ; Johnston & Peters, 1996Down ).

All alphaviruses share a number of structural, sequence and functional similarities, including a genome with two polyprotein gene clusters (reviewed in Strauss & Strauss, 1994Down ; Schlesinger & Schlesinger, 1996Down ). The genomic organization of these viruses is conserved. The nonstructural proteins are translated directly from the 5' two-thirds of the genomic RNA. A subgenomic, positive-stranded RNA (the 26S RNA), transcribed from a negative-strand RNA, is identical to the 3' one-third of the genomic RNA and serves as the mRNA for the structural proteins (capsid, E3, E2, 6K and E1). The nonstructural proteins (nsP1, nsP2, nsP3 and nsP4) are also synthesized as a polyprotein and processed into the four nsPs by an nsP2 protease. Two versions of the nonstructural polyprotein are synthesized in alphavirus-infected cells, due to frequent readthrough of an opal codon between the nsP3 and nsP4 genes in several alphaviruses (Strauss et al., 1983Down ). The nsPs function in a complex with host factors to replicate the genome and transcribe the subgenomic mRNA. Alphaviruses have characteristic conserved sequences at the extreme 5' and 3' domains and the intergenic region (Ou et al., 1982Down , 1983Down ; Pfeffer et al., 1998Down ). These conserved domains are required for virus growth and replication and are believed to be important in promotion of protein synthesis and the initiation of RNA-dependent RNA polymerase activity.

The serological relationship between WEE isolates has been determined by neutralization tests (Calisher et al., 1988Down ). Additionally, several strains of WEE were typed by oligonucleotide fingerprinting and found to have greater than 90% nucleotide relatedness (Trent & Grant, 1980Down ). The N-terminal sequences of the nucleocapsid and the E1 and E2 glycoproteins have been determined, and the E1 and E2 proteins were found to have 82 and 71% identity, respectively, to those of SIN (Bell et al., 1983Down ). Hahn et al. (1988)Down sequenced the 26S region of WEE strain BFS1703 and proposed that WEE originated as a hybrid virus, formed by recombination of an eastern encephalitis virus (EEE) and a SIN-like virus, probably during a co-infection event. They suggested that two crossover events occurred, one within the E3 gene, the other within the 3' nontranslated terminal region (NTR), resulting in a virus the nonstructural domain, intergenic region and capsid protein of which are similar to EEE and with envelope proteins showing similarity to SIN. Comparison of the 3' NTR from a number of alphaviruses revealed that conserved repeated elements are present (Ou et al., 1982Down ). Two 40 base direct repeats were identified from the 3' NTR of WEE (Hahn et al., 1988Down ). The sequence motif is found in nearly identical form in a number of other SIN-like viruses, although the position of these motifs and their number (two or three) varies with the individual virus (Ou et al., 1982Down ; Pfeffer et al., 1998Down ). Weaver et al. (1993)Down sequenced part of the nonstructural domain (nsP2 and nsP3 genes) of WEE strain 5614, demonstrating that this area also shows similarity to EEE. Short regions within the nsP4 gene and the E1 protein/3' NTR have been determined for many WEE strains, allowing a preliminary assessment of the nucleic acid phylogenetic relationships within the WEE antigenic complex (Weaver et al., 1997Down ). Serological studies (Calisher et al., 1988Down ) and preliminary sequence determination (Cilnis et al., 1996Down ; Weaver et al., 1997Down ) of the HJ genome suggests that this is another closely related virus and is probably a descendant of the same recombinant virus ancestor as modern WEE. A highly conserved region of the alphavirus nsP1 gene has been identified and proved suitable for use in a PCR-based genetic assay for alphaviruses, including WEE (Pfeffer et al., 1997Down ). Phylogenetic analysis of this PCR fragment yielded results similar to those obtained by Weaver et al. (1997)Down for a PCR fragment in the nsP4 gene.

Our interest in WEE covers a number of facets, including the development of subunit vaccines to WEE, the development of a passive immunization approach by using human/humanized antibodies and the diagnosis of WEE by immunological and genetic approaches. As a first step towards these goals, we report the first complete sequence of a WEE virus (strain 71V-1658) and discuss the significance of the data. The structural genes were expressed from a plasmid vector in the initial step towards the development of a subunit vaccine to WEE.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Virus culture and purification.
Cell culture was maintained in accordance with established methods (Bird & Forrester, 1981Down ). Minimal essential medium containing 5% foetal calf serum (5% DMEM) was used to grow Vero (CRL 1586) and Chinese hamster ovary (CHO) K1 (CCL 61) cells obtained from ATCC. A 10% suckling mouse brain (SMB) suspension of WEE strain 71V-1658 was kindly provided by Nick Karabatsos (Centers for Disease Control, Fort Collins, CO, USA). This strain was isolated in Oregon (August 13, 1971) from the brain tissue of an infected horse. A seed stock of 71V-1658 was made by inoculation of Vero cells with the SMB suspension at an m.o.i. of less than 0·1. Virus stocks were prepared by infecting Vero cells at an m.o.i. of 10. The virus was precipitated from cleared supernatant by the addition of polyethylene glycol 6000 to 7% (w/v) and NaCl to 2·3% (w/v). Virus was subsequently purified on a 20–60% (w/w) continuous sucrose gradient, followed by resuspension in PBS. WEE strain CBA87, used in 5'-terminal sequencing reactions, was isolated in Cordoba, Argentina (1958) from the brain tissue of an infected horse and was kindly provided by T. P. Monath (Orvax Inc., Cambridge, MA, USA).

{blacksquare} Nucleic acid preparation.
Viral RNA used in construction of a WEE strain 71V-1658 library was prepared by the lysis of virus in 0·5% (w/v) SDS and extracted with caesium chloride/guanidium isothiocyanate (Sambrook et al., 1989Down ). RNA was precipitated with sodium acetate and ethanol and stored at -70 °C. Prior to use, RNA was washed with 80% (v/v) ethanol, dried and dissolved in nuclease-free water (Promega). A cDNA library of WEE strain 71V-1658 was made by Invitrogen by the ligation of cDNA into the BstXI site of prepared pcDNAII vector and electroporation into electrocompetent DH1{alpha} F' Escherichia coli cells. Manipulation of RNA and DNA followed established procedures (Sambrook et al., 1989Down ; Ausubel et al., 1995Down ). Rapid plasmid preparations were made by using the Wizard plasmid purification kit (Promega). Large-scale plasmid preparations were made by the alkaline lysis protocol as modified by Qiagen. For PCR, RT–PCR and DNA sequencing, oligonucleotide primer design was guided by information from other partially sequenced WEE strains (Hahn et al., 1988Down ; Weaver et al., 1993Down ) and from regions of sequence conservation (Ou et al., 1982Down , 1983Down ). A catalogue of the sequences of primers used in this study can be supplied on request.

{blacksquare} Construction of a cDNA clone encoding the structural genes.
The WEE cDNA library was screened by dot-blot hybridization (Sambrook et al., 1989Down ) with 32P-labelled, random-primed RT–PCR fragments as probes (Amersham). A 3100 bp insert, pcDW-12, was identified and corresponded to the 3' end of the 26S RNA. The missing 5' end of the 26S region was generated by RT–PCR by using the primers WEE5'Sst1 (5' TCCAGATACGAGCTCATACT) and WEEP3 (5' CTTCAAGTGATCGTAAACGT). The 1500 bp SstI/NcoI-restricted fragment was inserted into the plasmid phT3T7BM+ (Boehringer Mannheim) to generate an XbaI site on the 5' end. The 1500 bp XbaI–NcoI fragment was excised, gel-purified and inserted into the XbaI and NcoI restriction sites of pcDW-12. The resulting clone, pcDWXH-7, encoded the complete 26S region of WEE 71V-1658.

{blacksquare} Expression of the structural genes.
The 26S region insert from pcDWXH-7 was cloned into the mammalian expression vector pCI (Promega). The pcDWXH-7 plasmid was first linearized with HindIII, followed by a Klenow fragment reaction to fill in the 5' overhang. The insert was then excised with XbaI, gel-purified and ligated into XbaI/SmaI-digested pCI vector. The pCXH-3 expression vector was then transfected into Vero or CHO K1 cells by using the cationic lipid Lipofectamine (Gibco/BRL). Briefly, Vero or CHO K1 cells were grown to 30–50% confluence in Costar 6-well plates. The monolayers were transfected with pCXH-3 in accordance with the manufacturer’s directions for a period of 5 h, followed by a further 29 h incubation after the addition of 5% DMEM. The monolayers were fixed in methanol:acetone (1:1) for 5 min and washed with PBS containing 0·1% (v/v) Tween 20 (PBS-T). The cells were incubated for 45 min at 37 °C with a 1:100 dilution (in PBS-T containing 3% BSA; PBS-TB) of concentrated cell supernatant from hybridoma cell lines expressing monoclonal antibodies to the WEE E1 (clone 11D2) or E2 (clone 3F3) proteins (L. P. Nagata, M. Long, G. V. Ludwig & J. Conley, unpublished data), followed by washing with PBS-TB. Monolayers were incubated with a 1:4000 dilution (in PBS-TB) of goat anti-mouse IgG/IgM (H & L) horseradish peroxidase conjugate (Caltag) for 45 min at 37 °C. After washing with PBS-T, 2 ml TruBlue HRP substrate (Kirkegaard & Perry Laboratories) was added and plates were incubated for a further 30 min at room temperature followed by microscopic examination.

{blacksquare} DNA sequencing.
Automated sequencing of the 26S region was performed by using the ABI Prism Dye Terminator or Big-Dye Terminator cycle sequencing kits with plasmid templates according to the manufacturer’s instructions (PE-Applied Biosystems). Sequencing reactions were purified on Centri-Sep columns (Princeton Separations) and analysed on an ABI 373 or 310 automated sequencer. For the nonstructural region, template cDNAs were generated in a single-step integrated RT–PCR procedure by using the Titan RT–PCR kit (Boehringer Mannheim), following the manufacturer’s suggested protocols. RT–PCR products were purified by using the QIAquick PCR purification kit (Qiagen) and sequenced (50–100 ng DNA per reaction). The extreme 5' end of the genome was not sequenced in WEE 71V-1658. However, a 5' RACE reaction (Frohman et al., 1988Down ) was used to obtain a cDNA fragment from the 5' terminus of WEE strain CBA87. Briefly, primer WEE559 (5' GGTAGATTGATGTCGGTGCATGG) was used to prime reverse transcription of the 5' terminus of the viral RNA. After poly(A) tailing of the cDNA with terminal transferase, a plus-sense primer (5' GTACTTGACTGACTGTTTTTTTTTTTTTTT) was used in conjunction with WEE559 to amplify the 5' terminus.

{blacksquare} Nucleotide sequence analysis and assembly.
Sequence traces were edited manually and assembled by using the Seqman component of the Lasergene DNA analysis software (DNASTAR). Codon preferences and patterns were assessed by using the CodonUse and CodonFrequency programs, while the overall frequencies of mononucleotides and dinucleotides were calculated by using the Composition program of the Wisconsin package, version 9.0 [Genetics Computer Group (GCG), Madison, WI, USA]. Quantitative assessments of sequence similarities (nucleotide and amino acid) were calculated by preliminary alignment with the Pileup program, followed by manual alignment adjustment and analysis with the Distances program (GCG). Amino acid sequences aligned as described were used as the basis for the generation of phylogenetic trees (GCG). The GeneQuest module of the Lasergene program (DNASTAR) was used to predict and calculate RNA secondary structures at the ends of the genomic RNA by using minimum energy calculations. Multiple sequence alignments were accomplished by using the Clustal component of MegAlign (DNASTAR).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Complete nucleotide sequence of WEE genome and deduced amino acids
The nucleotide sequence of WEE strain 71V-1658 was determined by several distinct sequencing strategies, as summarized in Fig. 1Down. The 5' terminus of 25 nt was not determined for this strain. However, it was determined by sequencing a 5' RACE product from strain CBA87. Excluding the terminal 5' cap structure and the 3' poly(A) tail, the genomic sequence of WEE was found to be 11508 bases long. The base composition was 28% A, 25% C, 25% G and 22% U. The dinucleotide usage of the WEE genome was compared with those values anticipated from the base composition. Several dinucleotides were found in lower proportions than anticipated, notably UpA (81%), CpG (83%) and CpC (85%) (data not shown). Codons containing the CpG dinucleotide were present at 82% of the anticipated value, including codons for serine (78%), proline (80%) and arginine (78%).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Diagram showing the WEE 71V-1658 sequencing strategy. The locations of PCR probe sequences used to screen the WEE cDNA library are also indicated, along with the genomic organization of the virus.

 
The WEE 71V-1658 sequence was used to conduct a variety of phylogenetic analyses with previously determined alphavirus sequences. The alphaviruses used in the analyses included EEE strain North American variant (GenBank accession no. X67111), o’nyong-nyong virus (ONN) strain Gulu (M33999), Ross River virus (RR) strain NB5092 (M20162), Semliki Forest virus (SFV) (J02361), SIN strain HR (J02363) and Venezuelan equine encephalitis virus (VEE) strain ID (L04653). The degree of conservation among the various sequences (nucleotide and amino acid) over the stereotypical alphavirus genome is shown in Table 1Down. The C-terminal domain of nsP3, which consistently fails to exhibit similarity among sequenced alphaviruses, was excluded from this comparison as it has been adjusted for in previous analyses (Weaver et al., 1993Down ). The deduced amino acid sequences for nsP1–4 of WEE 71V-1658 demonstrated closest identity to the corresponding proteins from EEE (Table 1Down), reflecting similar observations made for nsP2 and nsP3 of WEE 5614 and EEE (Weaver et al., 1993Down ).


View this table:
[in this window]
[in a new window]
 
Table 1. Percentage divergence in nucleotide and deduced amino acid sequences between WEE 71V-1658 and other alphaviruses

 
Nontranslated terminal regions (NTRs)
Alignment of the 5'-terminal nucleotide sequences of WEE CBA87 and WEE 71V-1658 is shown in Fig. 2(a)Down, along with a comparison of the 5' termini from EEE and VEE. The close similarity between WEE and EEE has been verified experimentally, in that an EEE/HJ degenerate primer, EHJ5', amplified the 5' end of the WEE genome when used in PCR, while an analogous SIN primer did not (data not shown).



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 2. Multiple sequence alignments. (a) The 5' termini of WEE CBA87 (nt 1–97), WEE 71V-1658 (25–240), EEE (1–238) and VEE (1–236) aligned via the Clustal module of DNASTAR. Areas where sequences are identical are boxed. (b) Hypervariable region identified in nsP1. Alignment of WEE 71V-1658 (nt 1420–1449), WEE 5614 (65–94) and EEE (1415–1444) is shown.

 
Potential stem–loop structures were found in WEE 71V-1658, including a stem–loop at the extreme 5' terminus (nt 2–30) and a pair of stem–loops (nt 137–189) (Fig. 3aDown). The homologous structures for EEE are also shown (Fig. 3bDown) (Ou et al., 1983Down ). Minimum energy values calculated for the stem–loops were similar for WEE and EEE. Further analysis of the region between the structures described above indicated a large, highly base-paired stem–loop structure (nt 39–131) that had not been described previously and was observed in SIN and EEE in a similar location (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. Stem–loop structures in the 5' NTR. Hairpin structures were identified by using the RNA folding program of the Genequest module (DNASTAR). Structures for WEE (CBA87/71V-1658) (nt 1–192) (a) and EEE (nt 1–192) (b) sequences are shown. Minimum free energy values (in kcal/mol) are shown for the different structures.

 
The sequence of the WEE 71V-1658 3' NTR shared little similarity overall with the alphaviruses examined, but included the highly conserved 19 nt region at the 3' end (nt 11490–11508), which was identical to that determined for WEE BFS1703 by Hahn et al. (1988)Down . Two copies of the characteristic 40 nt SIN-like terminal repeats, as reported previously (Ou et al., 1982Down ), were found in WEE 71V-1658 (nt 11234–11273 and 11292–11331). However, the 3' NTR of WEE showed some surprising features that had not been described previously. The first 40 nt terminal repeat formed the backbone for the formation of a 57 nt double stem–loop structure (nt 11228–11284) (Fig. 4bDown), consisting of an {alpha} and a {beta} loop. The second 40 nt repeat of WEE formed a nearly identical 59 nt double stem–loop structure (nt 11285–11343), directly adjacent to the first structure. SIN, with three 40 nt repeats, forms three double stem–loops (Fig. 4aDown), while EEE, which does not contain a SIN-like 40 nt repeat, contains the {alpha} and {beta} loops (Fig. 4cDown).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. Stem–loop structures in the 3' NTR. (a) Double stem–loop structures in SIN. (b) Double stem–loop structures in 3' NTR of WEE. Residues in the SIN-like 40 nt repeat are shaded. (c) Stem–loop structures in EEE.

 
Nonstructural region
Comparisons within the nonstructural regions (4475 nt) of WEE strains 71V-1658 and 5614 (Weaver et al., 1993Down ) yielded 94 nt changes, resulting in 26 amino acid substitutions (1·8% difference), as summarized in Table 1Up. The most notable variation, a three-base deletion (nt 4530) within the nsP3 gene of WEE 71V-1658, constitutes the only insertion/deletion observed within the polypeptide-encoding regions. A short hypervariable region was observed (nt 1421–1449), where 11 of 28 nucleotides were different between the two WEE strains (Fig. 2bUp). The presence of an opal termination codon and partial readthrough site at the junction of nsP3 and nsP4 is consistent with results for WEE 5614. Extending previous phylogenetic analyses of WEE (Weaver et al., 1993Down , 1997Down ), phylogenetic trees depicting virus relatedness were constructed with the Distances program (GCG) for the previously unexamined genes (nsP1, nsP4) and the entire nsP-encoding region (Fig. 5Down). The data reveal the close relationship of WEE to EEE, relative to the other alphaviruses analysed.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5. Phylogenetic relationships of the WEE nonstructural region to those of other alphaviruses. Comparisons of nsP1 (a), nsP4 (b) and nsP1–4 (c) are shown.

 
Structural region
The largest WEE cDNA clone isolated, pcDW-12, was 3100 bp in size. The remaining 5' fragment of 1500 bp was synthesized by using RT–PCR and subsequently cloned into pcDW-12 to yield a full-length clone of the 26S region (pcDWXH-7). Comparison of the structural genes of WEE 71V-1658 with those of WEE BFS1703 (Hahn et al., 1988Down ) indicated 53 nucleotide changes, resulting in only 11 amino acid differences (Table 1Up), of which two were not conservative. A single residue difference was observed in the amino acid sequences of the N terminus of the E2 protein between the WEE strains MacMillan (Bell et al., 1983Down ) and 71V-1658. A 799 bp PCR fragment of the WEE 71V-1658 E1 protein gene together with the 3' NTR has been published previously (Weaver et al., 1997Down ) and comparison with the sequence reported in this study indicated no differences.

Expression of 26S region
Expression of the structural proteins of WEE 71V-1658 was accomplished by placing the structural genes under the control of the cytomegalovirus (CMV) promoter in the pCI vector. Expression was assayed after cationic liposome-mediated transfection of Vero or CHO K1 cells with pCXH-3 by using histochemical staining with E1- or E2-specific monoclonal antibodies (L. P. Nagata, M. Long, G. V. Ludwig & J. Conley, unpublished data), as shown in Fig. 6(a)Down. The control cells transfected with pCI alone showed no staining (Fig. 6b).



View larger version (99K):
[in this window]
[in a new window]
 
Fig. 6. Expression of WEE structural genes in cell culture. One µg plasmid DNA was transfected into Vero cells. (a) pCXH-3; (b) pCI (control plasmid).

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The WEE 71V-1658 genomic sequence of 11508 bases was determined directly from cDNA clones of WEE or by sequencing RT–PCR products. The first 25 bases of the WEE genome were determined indirectly through the use of a 5' RACE reaction in WEE CBA87. Noting the relatively high conservation in the WEE sequences both overall (1·7% divergence) and in the overlap region between the two WEE sequences (see Fig. 2aUp), we are confident that the 5' ends of 71V-1658 and CBA87 are of similar size and sequence.

Comparison of the sequence of WEE 71V-1658 with other partial sequences of WEE (Hahn et al., 1988Down ; Weaver et al., 1993Down ) appears to indicate little variation at the nucleotide level among these viruses (Table 1Up), showing an overall nucleotide sequence difference of 1·7% over 8624 bases. Given a calculated rate of divergence of 0·028% per year for the WEE E1 protein (Weaver et al., 1997Down ), the expected nucleotide divergence for a difference in isolation of 18 years between the strains should be 0·5% (71V-1658 isolated in 1971 and BFS1703 in 1953). The E1 protein itself showed a divergence of 1·5% in nucleotide sequence between 71V-1658 and BFS1703. The lower rate observed by Weaver et al. (1997)Down could be due to greater conservation of structure at the C terminus of E1, from where the rates of divergence were calculated. Areas with high rates of divergence between WEE strains 71V-1658 and 5614 were observed at the 3' end of nsP1 and the 5' end of nsP4 (Table 1Up). The relatively high interstrain divergence of nsP1 (4·5%) may be due the presence of a small hypervariable region, with 11 of 28 nucleotides changed in strain 5614 (Fig. 2bUp). Variation in nsP4 occurred in a stretch of 21 nucleotides at the 3' end of the 5614 sequence; these residues were left out of subsequent comparisons (similarity with the EEE sequence was maintained in this region). Discounting the C-terminal region of nsP3 also gives a more accurate picture of the similarity of the nsP1–4 nonstructural region (Weaver et al., 1993Down ). The results of comparisons of nucleotide and amino acid sequences of WEE with other alphaviruses are shown in Table 1Up, and are similar to those obtained for nsP2 and nsP3 of strain 5614, when compared with other alphavirus sequences. Phylogenetic analysis of the WEE 71V-1658 deduced amino acid sequences of nsP1, nsP4 and the nsP1–4 region, as related to other alphaviruses (Fig. 5Up), illustrates the close relationship to EEE (HJ sequences were very limited for comparative purposes and were not included).

Assessments of codon-usage frequencies and the frequencies at which certain dinucleotides were found throughout the genome identified a number of statistical anomalies. The slight CpG dinucleotide deficiency described previously within other alphaviruses including WEE was confirmed in this study, at levels comparable to those reported previously (Weaver et al., 1993Down ). The CpG under-representation is a typical feature of vertebrate genomes and is not seen in invertebrates. Viruses that infect two hosts, such as the arboviruses, might be expected to utilize an intermediate nucleotide bias, as indicated by the slight CpG under-utilization observed in alphaviruses (Weaver et al., 1993Down ). Pronounced under-representation of two other dinucleotides, UpA and CpC, was also observed within the WEE genome, a phenomenon noted throughout the genome, although the role of these codon preferences is unclear.

The 5' NTR sequence of WEE showed close phylogenetic affiliation to EEE and HJ, although the HJ sequence information was more limited. Ou et al. (1983)Down had previously predicted (on the basis of minimum free energy calculations) two hairpin structures at the 5' NTR of several alphaviruses, including SIN and EEE. Both structures are present in WEE, the first of which is a 5'-terminal hairpin structure (nt 2–30) similar to that calculated for EEE (Fig. 3aUp, bUp). The second is a dual hairpin structure (nt 137–162, 165–189) that is almost identical to that identified for EEE. The region between the terminal and dual hairpins can itself form a long hairpin structure and includes highly conserved stretches of 92 nucleotides (data not shown). The significance of these structures is currently unknown.

Previous reports (Hahn et al., 1988Down ; Pfeffer et al., 1998Down ) suggested that WEE arose as a result of two recombination events between alphavirus-like ancestral viruses. The first recombination occurred near the junction of the E3 and capsid genes. The second recombination occurred 80 nucleotides from the 3' end of the genome. Evidence for the occurrence of the second recombination event is inferred from sequence similarities of the 3' NTR between WEE, EEE and SIN, in which WEE shows greater similarity to EEE (65%) than to SIN (50%) in the last 100 nucleotides of the 3' end. However, the apparent plasticity of the 3' NTR may simply reflect the selective pressures under which the nascent WEE virus evolved, resulting in rapid selection of 3' sequences that were more similar to EEE, and may not represent an actual recombination event as previously postulated.

The 3' NTRs of alphaviruses are characterized by widespread sequence divergence and yet contain small, strongly conserved motifs (reviewed in Strauss & Strauss, 1994Down ; Pfeffer et al., 1998Down ). Analysis of the 3' NTR indicated the presence of double stem–loop structures in SIN and WEE (Fig. 4aUp, bUp). Interestingly, the 40 base repeat found in SIN and WEE is contained within the double stem–loop structure. SIN was found to contain three double stem–loop structures and WEE was found to contain two. In SIN, the spacing between the three double stem–loop structures was around 30 nucleotides, while in WEE, the distance was zero nucleotides. Additional alphaviruses were assessed and it is interesting to note that double stem–loop structures were found in many of the WEE-and SIN-related viruses (SIN, Aura, Babanki, Ockelbo, Kyzylagach, Whataroa, WEE and HJ). The double stem–loop structures found in SIN and WEE consisted of the {alpha} loop [AUGUA(U/C)UU] and the {beta} loop (GCAUAAU) (Fig. 4bUp). Surprisingly, while EEE does not have the 40 base repeat element found in SIN and WEE, it contains the {alpha} and {beta} loop structures (Fig. 4cUp). The significance of these loop structures conserved between SIN, WEE and EEE has yet to be elucidated, although previous studies have suggested a role in virus replication and/or host specificity (Kuhn et al., 1990Down , 1991Down ). For example, a deletion of 26–318 nucleotides from the 3' end of SIN resulted in reduced virus replication in mosquito cells but not in chicken cells (Kuhn et al., 1990Down ). In contrast, substitution of the SIN 3' NTR with the substantially different RR 3' NTR (which lacks the 40 base repeat and double stem–loop structures) had no effect on the growth of the chimeric virus in mosquito cells, prompting the authors to suggest that host proteins interact with the 3' NTRs to cause differential host effects (Kuhn et al., 1991Down ).

The structural genes of 71V-1658 were placed under the control of the CMV promoter of pCI. Expression of WEE structural proteins from pCXH-3 when transfected into Vero cells indicated that the E1 (Fig. 6aUp) and E2 proteins (data not shown) were processed properly and were recognized by monoclonal antibodies that were isolated from mice immunized with inactivated whole virus particles. The binding specificities of these monoclonal antibodies have been determined previously by Western blot analysis and immunoprecipitation analysis (L. P. Nagata, M. Long, G. V. Ludwig & J. Conley, unpublished results). The evaluation of this plasmid as a vehicle for DNA immunization is currently under way, as a first step in the development of a potential DNA vaccine to WEE. Preliminary results indicate that WEE-reactive antibodies can be detected by ELISA when the pCXH-3 plasmid is administered intramuscularly to mice (unpublished results).


   Acknowledgments
 
We would like to thank Ms V. Roberts and Ms S. Ewing for technical illustration and Mr R. Lynde for photographic support. D.J.N. was funded as a postdoctoral fellow through the National Sciences and Engineering Research Council of Canada.


   Footnotes
 
The GenBank accession number of the sequence reported in this paper is AF143811.

b Present address: Dept of Sciences & Technologies, Medicine Hat College, 299 College Dr. SE, Medicine Hat, Alberta, Canada. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (editors) (1995). Current Protocols in Molecular Biology. New York: John Wiley.

Bell, J. R., Bond, M. W., Hunkapiller, M. W., Strauss, E. G., Strauss, J. H., Yamamoto, K. & Simizu, B. (1983). Structural proteins of Western equine encephalitis virus: amino acid compositions and N-terminal sequences. Journal of Virology 45, 708-714.[Abstract/Free Full Text]

Bird, B. R. & Forrester, F. T. (1981). Basic Laboratory Techniques in Cell Culture. Atlanta: US Department of Health and Human Services, Centers for Disease Control.

Calisher, C. H. & Karabatsos, N. (1988). Arbovirus serogroups: definition and geographic distribution. In The Arboviruses: Epidemiology and Ecology, pp. 19-57. Edited by T. P. Monath. Boca Raton, FL: CRC Press.

Calisher, C. H., Shope, R. E., Brandt, W., Casals, J., Karabatsos, N., Murphy, F. A., Tesh, R. B. & Wiebe, M. E. (1980). Proposed antigenic classification of registered arboviruses. I. Togaviridae, Alphavirus. Intervirology 14, 229-232.[Medline]

Calisher, C. H., Karabatsos, N., Lazuick, J. S., Monath, T. P. & Wolff, K. L. (1988). Reevaluation of the western equine encephalitis antigenic complex of alphaviruses (family Togaviridae) as determined by neutralization tests.American Journal of Tropical Medicine and Hygiene 38, 447-452.

Cilnis, M. J., Kang, W. & Weaver, S. C. (1996). Genetic conservation of Highlands J viruses.Virology 218, 343-351.[Medline]

Frohman, M. A., Dush, M. K. & Martin, G. R. (1988). Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer.Proceedings of the National Academy of Sciences, USA 85, 8998-9002.[Abstract/Free Full Text]

Hahn, C. S., Lustig, S., Strauss, E. G. & Strauss, J. H. (1988). Western equine encephalitis virus is a recombinant virus.Proceedings of the National Academy of Sciences, USA 85, 5997-6001.[Abstract/Free Full Text]

Johnston, R. E. & Peters, C. J. (1996). Alphaviruses. In Fields Virology, pp. 843-898. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Raven Press.

Kuhn, R. J., Hong, Z. & Strauss, J. H. (1990). Mutagenesis of the 3' nontranslated region of Sindbis virus RNA. Journal of Virology 64, 1465-1476.[Abstract/Free Full Text]

Kuhn, R. J., Niesters, H. G. M., Hong, Z. & Strauss, J. H. (1991). Infectious RNA transcripts from Ross River virus cDNA clones and the construction and characterization of defined chimeras with Sindbis virus.Virology 182, 430-441.[Medline]

Ou, J.-H., Trent, D. W. & Strauss, J. H. (1982). The 3'-non-coding regions of alphavirus RNAs contain repeating sequences.Journal of Molecular Biology 156, 719-730.[Medline]

Ou, J.-H., Strauss, E. G. & Strauss, J. H. (1983). The 5'-terminal sequences of the genomic RNAs of several alphaviruses.Journal of Molecular Biology 168, 1-15.[Medline]

Pfeffer, M., Proebster, B., Kinney, R. M. & Kaaden, O.-R. (1997). Genus-specific detection of alphaviruses by a semi-nested reverse transcription–polymerase chain reaction.American Journal of Tropical Medicine and Hygiene 57, 709-718.

Pfeffer, M., Kinney, R. M. & Kaaden, O.-R. (1998). The alphavirus 3'-nontranslated region: size heterogeneity and arrangement of repeated sequence elements.Virology 240, 100-108.[Medline]

Reisen, W. K. & Monath, T. P. (1988). Western equine encephalomyelitis. In The Arboviruses: Epidemiology and Ecology, pp. 89-137. Edited by T. P. Monath. Boca Raton, FL: CRC Press.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schlesinger, S. & Schlesinger, M. J. (1996). Togaviridae: the viruses and their replication. In Fields Virology, pp. 825-841. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Strauss, J. H. & Strauss, E. G. (1988). Evolution of RNA viruses.Annual Review of Microbiology 42, 657-683.[Medline]

Strauss, J. H. & Strauss, E. G. (1994). The alphaviruses: gene expression, replication, and evolution.Microbiological Reviews 58, 491-562.[Abstract/Free Full Text]

Strauss, E. G., Rice, C. M. & Strauss, J. H. (1983). Sequence coding for the alphavirus nonstructural proteins is interrupted by an opal termination codon.Proceedings of the National Academy of Sciences, USA 80, 5271-5275.[Abstract/Free Full Text]

Trent, D. W. & Grant, J. A. (1980). A comparison of New World alphaviruses in the western equine encephalomyelitis complex by immunochemical and oligonucleotide fingerprint techniques.Journal of General Virology 47, 261-282.[Abstract/Free Full Text]

Weaver, S. C., Hagenbaugh, A., Bellew, L. A., Netesov, S. V., Volchkov, V. E., Chang, G.-J. J., Clarke, D. K., Gousset, L., Scott, T. W., Trent, D. W. & Holland, J. J. (1993). A comparison of the nucleotide sequences of eastern and western equine encephalomyelitis viruses with those of other alphaviruses and related RNA viruses. Virology 197, 375-390.[Medline]

Weaver, S. C., Kang, W., Shirako, Y., Rumenapf, T., Strauss, E. G. & Strauss, J. H. (1997). Recombinational history and molecular evolution of western equine encephalomyelitis complex alphaviruses.Journal of Virology 71, 613-623.[Abstract]

Received 13 July 1999; accepted 28 September 1999.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
C. H. Logue, C. F. Bosio, T. Welte, K. M. Keene, J. P. Ledermann, A. Phillips, B. J. Sheahan, D. J. Pierro, N. Marlenee, A. C. Brault, et al.
Virulence variation among isolates of western equine encephalitis virus in an outbred mouse model
J. Gen. Virol., August 1, 2009; 90(8): 1848 - 1858.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
L. P. Nagata, W.-G. Hu, M. Parker, D. Chau, G. A. Rayner, F. L. Schmaltz, and J. P. Wong
Infectivity variation and genetic diversity among strains of Western equine encephalitis virus.
J. Gen. Virol., August 1, 2006; 87(Pt 8): 2353 - 2361.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. A. van Dijk, E. V. Makeyev, and D. H. Bamford
Initiation of viral RNA-dependent RNA polymerization
J. Gen. Virol., May 1, 2004; 85(5): 1077 - 1093.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. M. Wielgosz, R. Raju, and H. V. Huang
Sequence Requirements for Sindbis Virus Subgenomic mRNA Promoter Function in Cultured Cells
J. Virol., April 15, 2001; 75(8): 3509 - 3519.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Netolitzky, D. J.
Right arrow Articles by Nagata, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Netolitzky, D. J.
Right arrow Articles by Nagata, L. P.
Agricola
Right arrow Articles by Netolitzky, D. J.
Right arrow Articles by Nagata, L. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS